View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4780_low_90 (Length: 210)
Name: NF4780_low_90
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4780_low_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 52519107 - 52519277
Alignment:
| Q |
1 |
gaatcgtttcacttctggaattttgnnnnnnnattgtttctggctatgtatcccaagtttcaaaattaattggagccttttcaaaatcatcagaagcccc |
100 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52519107 |
gaatcgtttcacttctggagttttgtttttttattgtttctggctatgtatcccaagtttcaaaat-aattggagccttttcaaaatcatcagaagcccc |
52519205 |
T |
 |
| Q |
101 |
aagaaatagtgatagtgagttcactagtataatatatttgatcaatctttctattatttcatgtttattagt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52519206 |
aagaaatagtgatagtgagttcactagtataatatatttgatcaatctttctattatttcatgtttattagt |
52519277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University