View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4780_low_93 (Length: 202)

Name: NF4780_low_93
Description: NF4780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4780_low_93
NF4780_low_93
[»] chr2 (1 HSPs)
chr2 (17-172)||(13464204-13464359)


Alignment Details
Target: chr2 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 17 - 172
Target Start/End: Original strand, 13464204 - 13464359
Alignment:
17 ttctctagtgtcgatttcctattgaaatcggtggcattatgctcttccacttggagttcagattatgtcatcccatattttctgcgaaggcaattgttgt 116  Q
    ||||||||||||||| |||||| | |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||    
13464204 ttctctagtgtcgatctcctatcggaatcggtggcattatgctattcgacttggagttcagattatgtcatcccatattttatgcgaaggcaattgttgt 13464303  T
117 gcttatgagcttgtgaatatggggcacttggttcggggatcagtttcgttgaatga 172  Q
    |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||    
13464304 gcttataagcttgcgaatatggggcacttggttcggggatcagtttcgttgaatga 13464359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University