View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4781_high_4 (Length: 351)
Name: NF4781_high_4
Description: NF4781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4781_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 75 - 272
Target Start/End: Original strand, 10408378 - 10408574
Alignment:
| Q |
75 |
aaaaatttaccatctagttttgatctatattggatggatgctagacttacacgaaaatttaccaactcaagagaccgacacgtctacatattggatgcaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10408378 |
aaaaatttaccatctagttttgatctatattggatg-atgtgagacttacacgaaaatttaccaactcaagagaccgacacgtctacatattggatgcaa |
10408476 |
T |
 |
| Q |
175 |
catacataagccaaaatcttaaaatttgagagagaacatatatgattttttatcaaacacatctgccgtatagaaggaagagtaatggctttaattag |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10408477 |
catacataagccaaaatcttaaaatttgagagagaacatatatgattttttatcaaacacatctgccgtatagaaggaagagtaatggctttaattag |
10408574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 7 - 80
Target Start/End: Original strand, 10408123 - 10408196
Alignment:
| Q |
7 |
agagtcgcatgcaaacttaatgtccttgatgtacgaatgcatcttgcaacgtagaaatcgaccaactcaaaaat |
80 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10408123 |
agagtcgcatgcaaacttaatgtctttgatgtacgaatgcatcttgcaacgtagaaatcgaccaactcaaaaat |
10408196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 290 - 341
Target Start/End: Original strand, 10408601 - 10408652
Alignment:
| Q |
290 |
aattagatgacccgtacacatttaaagtcaggttggaaaactatgatgatgt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10408601 |
aattagatgacccgtacacatttaaagtcaggttggaaaactatgatgatgt |
10408652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University