View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4781_high_7 (Length: 251)
Name: NF4781_high_7
Description: NF4781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4781_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 34616476 - 34616236
Alignment:
| Q |
1 |
ctcctgcagttgctgcaatgataatgagaagaaggaataacaagcttatcgtccaacatatacacttgcaaaaacagcttctttttggttttgaagagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
34616476 |
ctcctgcagttgctgcaatgataatgagaagaaggaataacaagcttattgtccaacatatacacttgcaaaaacagcttatttttggctttgaagagtt |
34616377 |
T |
 |
| Q |
101 |
tattgctggcatagcatgttgatgcagcattggaggaggcacatggataaccttttctgatctagaggaacctggaggtactaatggtgtcctagggtgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34616376 |
tattgctggcatagcatgttgatgcagtattggaggaggcacatggataaccttttctgatctagaggaacctggaggtactaatggtgtcctagggtgt |
34616277 |
T |
 |
| Q |
201 |
ggttttgtttccacattcataggatggattctctgtctctg |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34616276 |
ggttttgtttccacattcatagggtggattctctgtctctg |
34616236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 2461955 - 2461904
Alignment:
| Q |
76 |
agcttctttttggttttgaagagtttattgctggcatagcatgttgatgcag |
127 |
Q |
| |
|
||||||| ||||||| |||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
2461955 |
agcttctctttggttgtgaatagtttatttctggtatagcatgttgatgcag |
2461904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University