View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4781_high_8 (Length: 224)
Name: NF4781_high_8
Description: NF4781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4781_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 41543747 - 41543933
Alignment:
| Q |
20 |
atgaaatgggtcatcatgcttaatgggtcatccaagaaactatgagaataagaagctatgttggtgagacatttctttgttgctagaaatagagctttga |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41543747 |
atgaaatgggtcatcatgtttaatgggtcatcctagaaaccatgagaataagaagctatgttggtgagacatttctttgttgctagaaatagagcttt-a |
41543845 |
T |
 |
| Q |
120 |
tactttagagattacctcggctttaattatgcagtggattcttgagacttaagaaagaaatattatttggaatgttcgaggtgttttt |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41543846 |
tactttagagattacctcgactttaattatgcaatggattcttgagacttaagaaagaaatattatttggaatgttcgaggtgttttt |
41543933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 100
Target Start/End: Complemental strand, 6468459 - 6468413
Alignment:
| Q |
54 |
agaaactatgagaataagaagctatgttggtgagacatttctttgtt |
100 |
Q |
| |
|
|||||| ||||||||| | |||||||||||||||||| ||||||||| |
|
|
| T |
6468459 |
agaaaccatgagaatagggagctatgttggtgagacacttctttgtt |
6468413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University