View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4781_low_5 (Length: 291)
Name: NF4781_low_5
Description: NF4781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4781_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 6 - 275
Target Start/End: Complemental strand, 31854781 - 31854506
Alignment:
| Q |
6 |
agcagcacagaacccgccaacacatcgcacagcaaaacagtacaggaaacaaaatctccactgcctcccc-acaaaacagacctgctcaagacagcagta |
104 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
31854781 |
agcagcacaaaaccccccaacacatcgcacagcaaaacagtacaggaaacaaaatctccactgcctcccccacaaaacagacctgcccaagacagcagta |
31854682 |
T |
|
| Q |
105 |
acagaagcaaattctgctgtcacagacacgcaggaaaacagtccataaaattttcccgttgtacttcatacctccaattggtcttatgtaccatttccat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31854681 |
acagaagcaaattctgctgtcacagacacgcaggaaaacagtccataaaatattcccgttgtacttcataccttcaattggtcttatgtaccatttccat |
31854582 |
T |
|
| Q |
205 |
tgc-----tattgtaattatactattgagtgaatgaaattttagtgcaattactacttctttatatcagttcttct |
275 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31854581 |
tgctgctatattgtaattatactattgagtgaatgaaattttagtgcaattactacttctttatatcagttcttct |
31854506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University