View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4781_low_9 (Length: 206)
Name: NF4781_low_9
Description: NF4781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4781_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 23 - 75
Target Start/End: Original strand, 18322322 - 18322374
Alignment:
| Q |
23 |
aaaaatccactatttagactcattttcaatttttcatattctcataaaaatct |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18322322 |
aaaaatccactatttagactcattttcaatttttcatattctcataaaaatct |
18322374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 75
Target Start/End: Original strand, 9152159 - 9152199
Alignment:
| Q |
35 |
tttagactcattttcaatttttcatattctcataaaaatct |
75 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
9152159 |
tttagacccatttttaatttttcatattctcagaaaaatct |
9152199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 35 - 74
Target Start/End: Original strand, 2764845 - 2764884
Alignment:
| Q |
35 |
tttagactcattttcaatttttcatattctcataaaaatc |
74 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2764845 |
tttagactcattttttatttttcatattctcataaaaatc |
2764884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 75
Target Start/End: Original strand, 34853696 - 34853736
Alignment:
| Q |
35 |
tttagactcattttcaatttttcatattctcataaaaatct |
75 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
34853696 |
tttagacccatttttaatttttcatattctcagaaaaatct |
34853736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University