View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4782-Insertion-5 (Length: 120)
Name: NF4782-Insertion-5
Description: NF4782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4782-Insertion-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 7 - 120
Target Start/End: Complemental strand, 12805493 - 12805380
Alignment:
| Q |
7 |
aaatcagacaagaaaatcaaagtcagattactcaacaacatcaatcttccacagatgcttcatcaactgctgctcaacctttagttcctcagnnnnnnng |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12805493 |
aaatcagacaagaaaatcaaagtcagattactcaacaacatcaatcttccacagatgcttcatcaactgctgctcaacctttagttcctcagaaaaaaag |
12805394 |
T |
 |
| Q |
107 |
aagaaatcaacctg |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12805393 |
aagaaatcaacctg |
12805380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University