View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4783-Insertion-7 (Length: 85)
Name: NF4783-Insertion-7
Description: NF4783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4783-Insertion-7 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
| [»] scaffold0214 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 6e-37; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 6e-37
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 16877631 - 16877554
Alignment:
| Q |
8 |
tactaaacatgaatttgagcccaatgattttgcgcatttactcctataaataaatcaagctttacatttagactctca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16877631 |
tactaaacatgaatttgagcccaatgattttgcgcatttactcctataaataaatcaagctttacatttagactctca |
16877554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 8 - 71
Target Start/End: Complemental strand, 34230747 - 34230684
Alignment:
| Q |
8 |
tactaaacatgaatttgagcccaatgattttgcgcatttactcctataaataaatcaagcttta |
71 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
34230747 |
tactaaacatgaatttgagcccgatgattttgcgcatttgttcctataaataaatcaatcttta |
34230684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 1e-16
Query Start/End: Original strand, 12 - 71
Target Start/End: Complemental strand, 34226615 - 34226556
Alignment:
| Q |
12 |
aaacatgaatttgagcccaatgattttgcgcatttactcctataaataaatcaagcttta |
71 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
34226615 |
aaacatgaatttgagcccgatgattttgcgcatttgttcctataaataaatcaatcttta |
34226556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214 (Bit Score: 50; Significance: 3e-20; HSPs: 1)
Name: scaffold0214
Description:
Target: scaffold0214; HSP #1
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 30112 - 30036
Alignment:
| Q |
8 |
tactaaacatgaatttgagcccaatgattttgcgcatttactcctataaataaatcaagctttacatttagactctca |
85 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||| ||||||| | ||||||||| |
|
|
| T |
30112 |
tactaaacatgaatttgagcccgatgattttgcgcatttgctcctataaat-aatcaatctttacactcagactctca |
30036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University