View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4784-Insertion-6 (Length: 253)
Name: NF4784-Insertion-6
Description: NF4784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4784-Insertion-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 7 - 253
Target Start/End: Complemental strand, 7459432 - 7459207
Alignment:
| Q |
7 |
agaaataacatgtcaaattcttaggaggaagtagtgttttagatatagataatgcattcataaaacatgtccaattaaaagagattttctttctaacaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7459432 |
agaaataacatgtcaaattcttaggaggaagtagtgttttagatatagataatgcattcataaaacatgtccaattaaaagagattttctttctaacaat |
7459333 |
T |
|
| Q |
107 |
catctcaaacattccatatcaagtgaaatatcttaaacttaatcgataaggttgaaaggataatcgatcactgtgaactatctttgctttttatgaagtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||| | |
|
|
| T |
7459332 |
catctcaaacattccatatcaagtgaaatatcttaaacttaatc---------------------gatcactattaactatctttgctttttatgaagct |
7459254 |
T |
|
| Q |
207 |
tatggtacaaaaggcgacaatagaatcaatttcaaaatagttaaaaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7459253 |
tatggtacaaaaggcgacaatagaatcaatttcaaaatagttaaaaa |
7459207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University