View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4784-Insertion-8 (Length: 51)
Name: NF4784-Insertion-8
Description: NF4784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4784-Insertion-8 |
 | |
|
| [»] scaffold0907 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0907 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: scaffold0907
Description:
Target: scaffold0907; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 3113 - 3156
Alignment:
| Q |
8 |
gttggtgttgtgttggttgtgcttgttgaagtttcaatagtgtc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3113 |
gttggtgttgtgttggttgtgcttgttgaagtttcaatagtgtc |
3156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University