View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4784_low_10 (Length: 230)
Name: NF4784_low_10
Description: NF4784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4784_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 7459427 - 7459625
Alignment:
| Q |
20 |
atttcttttgagcatacccttatctcaattcttacgagagtttatttattatccttattaattaaatcatatacattcttttgtatttgctttagtttat |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7459427 |
atttcttctgagcatacccttatctcaattcttacgagagtgtatttattatccttattaattaaatcatatacattcttttgtatttgctttagattat |
7459526 |
T |
 |
| Q |
120 |
cggtataatcacctattgcgtttggttggataagtaagttggtgaaaaatacttggttggagttgattcacaacttagtgtttggttggagtataatct |
218 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7459527 |
cggtataatcatctattacgtttggttggataagtaagttggtgaaaaatacttggttggagttgattcacaacttagtgtttggttggagtataatct |
7459625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 129 - 209
Target Start/End: Original strand, 17336542 - 17336615
Alignment:
| Q |
129 |
cacctattgcgtttggttggataagtaagttggtgaaaaatacttggttggagttgattcacaacttagtgtttggttgga |
209 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
17336542 |
cacctattgtatttggtttgataagtaagttggtgtaaaatacttgg-------tgattcacaacttagtctttggttgga |
17336615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University