View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785-Insertion-10 (Length: 131)
Name: NF4785-Insertion-10
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 6 - 126
Target Start/End: Original strand, 45228913 - 45229033
Alignment:
| Q |
6 |
caattttcacattttcttaacttcaaagtttgaatttttatctcatttcagatatgggtttttcaagaaatgacgatttcgctccataatctcatatggg |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45228913 |
caattttcacactttcttaacttcaaagtttgaatttttatctcatttcagatatgggttttgcaagaaatgacgatttcgctccataatctcatctggg |
45229012 |
T |
|
| Q |
106 |
tcgtgcttattttcaccttct |
126 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45229013 |
tcgtgcttattttcaccttct |
45229033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 95 - 126
Target Start/End: Original strand, 45229031 - 45229062
Alignment:
| Q |
95 |
tctcatatgggtcgtgcttattttcaccttct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45229031 |
tctcatatgggtcgtgcttattttcaccttct |
45229062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 6 - 127
Target Start/End: Complemental strand, 7235248 - 7235127
Alignment:
| Q |
6 |
caattttcacattttcttaacttcaaagtttgaatttttatctcatttcagatatgggtttttcaagaaatgacgatttcgctccataatctcatatggg |
105 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
7235248 |
caattttcacactttcttaacttcaaagtttgaatttttatctcatttcagatatgggttttgcaagatatgacgatttcactccataatctcatctggg |
7235149 |
T |
|
| Q |
106 |
tcgtgcttattttcaccttctg |
127 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
7235148 |
tcgtgcttattttcactttctg |
7235127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 6 - 126
Target Start/End: Original strand, 30641394 - 30641514
Alignment:
| Q |
6 |
caattttcacattttcttaacttcaaagtttgaatttttatctcatttcagatatgggtttttcaagaaatgacgatttcgctccataatctcatatggg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
30641394 |
caattttcacattttcttaacttcaaagtttgaatttttatctcatttcagatatgagttttgcaaaaaatgacgatttcgctccataatctcatctggg |
30641493 |
T |
|
| Q |
106 |
tcgtgcttattttcaccttct |
126 |
Q |
| |
|
| || |||||||||||||||| |
|
|
| T |
30641494 |
ttgttcttattttcaccttct |
30641514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University