View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785-Insertion-12 (Length: 121)
Name: NF4785-Insertion-12
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785-Insertion-12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 6 - 106
Target Start/End: Complemental strand, 16164883 - 16164783
Alignment:
| Q |
6 |
caaatatgagggtaaaagacaagcttcgctttcaattgtgttatccccattacagtttctctgttgaaattataaggaacaaacccaaataatttaaggt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16164883 |
caaatatgagggtaaaagacaagcttcgctttcaattccgttatccccattacagtttctctgttgaaattataaggaagaaacccaaataatttaaggt |
16164784 |
T |
 |
| Q |
106 |
a |
106 |
Q |
| |
|
| |
|
|
| T |
16164783 |
a |
16164783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University