View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785-Insertion-8 (Length: 214)
Name: NF4785-Insertion-8
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785-Insertion-8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 8 - 214
Target Start/End: Complemental strand, 4271395 - 4271189
Alignment:
| Q |
8 |
gttcggtaatgaagttcagccat-tgtgtctatatctccgactacaaagtagcgg-aattatattttattatttgcgaaagattttggttt-cagtgaac |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4271395 |
gttcggtaatgaagttcagccaaatgtgtctatgtctccgactacaaagtagcggcaattatgttttattatttgcgaaagattttggtttacagtgaac |
4271296 |
T |
|
| Q |
105 |
tgtaatgtgggacatttgcatcccacaccctcagtcgcccccacaacaaaaaattggaccagatgctcattaggccaagcgcaagggctaggtctcactc |
204 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
4271295 |
tgtaatgtgggacctttgcctcccacaccctcagtcgcccccacaacaaaaaattggaccaaatgttcattaggcca---gcaagggctaggtctcactc |
4271199 |
T |
|
| Q |
205 |
gctttgctca |
214 |
Q |
| |
|
|||||||||| |
|
|
| T |
4271198 |
gctttgctca |
4271189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University