View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785-Insertion-9 (Length: 115)
Name: NF4785-Insertion-9
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785-Insertion-9 |
 | |
|
| [»] scaffold0445 (1 HSPs) |
| | |
|
| [»] scaffold0425 (1 HSPs) |
| | |
|
| [»] scaffold2089 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 45; Significance: 4e-17; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 44 - 112
Target Start/End: Complemental strand, 7588835 - 7588769
Alignment:
| Q |
44 |
tactctttatttccgttgttactcaaatttcatgtttcacatattttatatttcgctctaaatctttct |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
7588835 |
tactcttaatttccgttgttactcaaatttcatgttgc-catattttatatttc-ctctaaatctttct |
7588769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 44 - 95
Target Start/End: Original strand, 6418291 - 6418342
Alignment:
| Q |
44 |
tactctttatttccgttgttactcaaatttcatgtttcacatattttatatt |
95 |
Q |
| |
|
||||||| |||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6418291 |
tactcttaatttccattgttactcaaatttcatatttcacatattttatatt |
6418342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 47 - 112
Target Start/End: Original strand, 6552162 - 6552226
Alignment:
| Q |
47 |
tctttatttccgttgttactcaaatttcatgtttcacatattttatatttcgctctaaatctttct |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||| || ||||||||| | |||||||||||||| |
|
|
| T |
6552162 |
tcttaatttccgttgttactcaaatttcatatttcatattttttatattgc-ctctaaatctttct |
6552226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 6510781 - 6510827
Alignment:
| Q |
44 |
tactctttatttccgttgttactcaaatttcatgtttcacatatttt |
90 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
6510781 |
tactctttatttccgtttttactcaaatttcatatttcacatttttt |
6510827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 52 - 112
Target Start/End: Original strand, 6822463 - 6822523
Alignment:
| Q |
52 |
atttccgttgttactcaaatttcatgtttcacatattttatatttcgctctaaatctttct |
112 |
Q |
| |
|
||||||||| || ||||||| |||| ||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
6822463 |
atttccgtttttgctcaaatctcatatttgacatattttatatttccctctgaatctttct |
6822523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 42; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 8829 - 8776
Alignment:
| Q |
44 |
tactctttatttccgttgttactcaaatttcatgtttcacatattttatatttc |
97 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
8829 |
tactcttaatttccgttgttactcaaatttcatatttcacattttttatatttc |
8776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0425 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0425
Description:
Target: scaffold0425; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 44 - 112
Target Start/End: Original strand, 5129 - 5196
Alignment:
| Q |
44 |
tactctttatttccgttgttactcaaatttcatgtttcacatattttatatttcgctctaaatctttct |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||| || ||||||||| | |||||||||||||| |
|
|
| T |
5129 |
tactcttaatttccgttgttactcaaatttcatatttcatattttttatattgc-ctctaaatctttct |
5196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2089 (Bit Score: 31; Significance: 0.000000009; HSPs: 1)
Name: scaffold2089
Description:
Target: scaffold2089; HSP #1
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 44 - 90
Target Start/End: Original strand, 877 - 923
Alignment:
| Q |
44 |
tactctttatttccgttgttactcaaatttcatgtttcacatatttt |
90 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
877 |
tactcttaatttacgttgttactcaaatttcatatttcacatttttt |
923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University