View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785_high_11 (Length: 268)
Name: NF4785_high_11
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 20 - 247
Target Start/End: Complemental strand, 48686217 - 48685986
Alignment:
| Q |
20 |
aatgaaaaattgacagcaatggaccaccatatgaccataccataccttatagtagcatttataatttgannnnnnnnnncaaggagcatttataatttga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
48686217 |
aatgaaaaattgacagcaatggaccaccatatgaccataccataccttatagtagcatttataatttcaatttttttttcaaggagcatttataatttga |
48686118 |
T |
 |
| Q |
120 |
tagtgaacacaagctcctcgtggtacnnnnnnnnnnnn----gtcaaatatctcattggattttttatgttaaatgtctatgataagttagttcgaataa |
215 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
48686117 |
tagtgaacacaagctccccgtggtacttttttttttttttttgtcaaatatctcattcgattttttatgttaaatgtttataataagttagttcgaataa |
48686018 |
T |
 |
| Q |
216 |
aatttcgttagaaattggttcattaaatcata |
247 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |
|
|
| T |
48686017 |
agtttcgttagaaattggttcattaaatcata |
48685986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University