View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4785_high_15 (Length: 237)

Name: NF4785_high_15
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4785_high_15
NF4785_high_15
[»] chr8 (1 HSPs)
chr8 (1-228)||(37320244-37320471)


Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 37320471 - 37320244
Alignment:
1 aggagagatgtaaattcatcatcaccatcaacatcatatggctctgttggttcttcttcatcttcatgggagaataactatggatatccacaatcaacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
37320471 aggagagatgtaaattcatcatcaccatcaacatcatatggctctgttggttcttcttcatcttcatgggaaaataactatggatatccacaatcaacat 37320372  T
101 atccataccctccacagcaaaatccatatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaataggaagtcgga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
37320371 atccataccctccacagcaaaatccatatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaataggaagttgga 37320272  T
201 taggagatattcaaggattgctgatgat 228  Q
    ||||||||||||||||||||||||||||    
37320271 taggagatattcaaggattgctgatgat 37320244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University