View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785_high_19 (Length: 214)
Name: NF4785_high_19
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 3959685 - 3959863
Alignment:
| Q |
18 |
cattcatgtttggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaacattggtttcaaaattattttggtac |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959685 |
cattcatgtatggaaacccgaatgactataataaccgctagaaaccctttacaatgtggaaattggcagcaaaacattggtttcaaaattattttggtac |
3959784 |
T |
|
| Q |
118 |
atatatatgccctttatcgttggtgaaacttatagagtaaatatatcccttcttttctgctcctaattctcttatgtct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959785 |
atatatatgccctttatcgttggtgaaacttatatagtaaatatatcccttcttttctgctcctaattctcttatgtct |
3959863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 93
Target Start/End: Complemental strand, 4021260 - 4021195
Alignment:
| Q |
28 |
tggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaaca |
93 |
Q |
| |
|
||||||||| ||||||| ||| |||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4021260 |
tggaaaccctaatgactctaacaaccaccagaaacccttcaggttgtggaaattggcagcaaaaca |
4021195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University