View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785_low_10 (Length: 359)
Name: NF4785_low_10
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 204 - 349
Target Start/End: Original strand, 28678554 - 28678699
Alignment:
| Q |
204 |
cacaaatactcatgaataatttaatttaacaattgaagagaaacagtaaccttaacacgtcttgtagcagcaactttctcaactttattgacaaattgat |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678554 |
cacaaatactcatgaataatttaatttaacaattgaagataaacagtaaccttaacacgtcttgtagcagcaactttctcaactttattgacaaattgat |
28678653 |
T |
|
| Q |
304 |
tgaaagagtaataaggtagcaaacgagagtgccagtcagagtataa |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28678654 |
tgaaagagtaataaggtagcaaacgagagtgccagtcagagtataa |
28678699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University