View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4785_low_17 (Length: 237)
Name: NF4785_low_17
Description: NF4785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4785_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 37320471 - 37320244
Alignment:
| Q |
1 |
aggagagatgtaaattcatcatcaccatcaacatcatatggctctgttggttcttcttcatcttcatgggagaataactatggatatccacaatcaacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37320471 |
aggagagatgtaaattcatcatcaccatcaacatcatatggctctgttggttcttcttcatcttcatgggaaaataactatggatatccacaatcaacat |
37320372 |
T |
|
| Q |
101 |
atccataccctccacagcaaaatccatatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaataggaagtcgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37320371 |
atccataccctccacagcaaaatccatatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaataggaagttgga |
37320272 |
T |
|
| Q |
201 |
taggagatattcaaggattgctgatgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37320271 |
taggagatattcaaggattgctgatgat |
37320244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University