View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4786-Insertion-1 (Length: 918)
Name: NF4786-Insertion-1
Description: NF4786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4786-Insertion-1 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0115 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 2e-91; HSPs: 25)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 2e-91
Query Start/End: Original strand, 279 - 449
Target Start/End: Complemental strand, 42576064 - 42575894
Alignment:
| Q |
279 |
taaagtcttgtggtggtgtgagttctgttgctattcggtggggggtgtggggcggttgtccatcttgcccatcctatgggttctacttttctttctttat |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42576064 |
taaagtcttgtggtggtgtgagttctgttgctattcggtggggggtgtggggcggttgtccatcttgcccatcctatgggttctacttttctttctttat |
42575965 |
T |
 |
| Q |
379 |
tgcagggtggagttgcagcttttcgttggagtgtctctagttccttgggtggttttttgtctgtgttagat |
449 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42575964 |
tgcagggtggagttgcagcttttcgttggagtgtctctagttccttgggtggttttttgtctgtgttagat |
42575894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 2e-58
Query Start/End: Original strand, 8 - 155
Target Start/End: Complemental strand, 42576314 - 42576168
Alignment:
| Q |
8 |
aatccgatgtgggactaaataaccaccgagtgttggccgctaacaggttgcattagttagtcctcgcattatcagtattttaaaatggatctattaaatt |
107 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42576314 |
aatccgatgtgggactaaatc-ccaccaagtgttggccaataacaggttgcattagttagtccttgcattatcagtattttaaaatggatctattaaatt |
42576216 |
T |
 |
| Q |
108 |
gcaaaatacatatcaagtttttcccaatatatgaatatgttatcaaat |
155 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42576215 |
gcaaaatgcatatcaagtttttcccaatatatgaatatgttatcaaat |
42576168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 100; E-Value: 6e-49
Query Start/End: Original strand, 800 - 918
Target Start/End: Complemental strand, 42575687 - 42575568
Alignment:
| Q |
800 |
tgtccatgtaattgccacaaaacagtaaactatccaagaacaagagaagctcaaat-aaattacaaaatatatacttattttaaaggagggatcaaaagt |
898 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
42575687 |
tgtccatgtaattgccacaaaacagtaaactatccaagaacaagagaagctcagattaaattacaaaatatatacttaatttaaaggaaggatcaaaagt |
42575588 |
T |
 |
| Q |
899 |
gaaaatgaaaatttttggga |
918 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42575587 |
gaaaatgaaaatttttggga |
42575568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 156 - 211
Target Start/End: Complemental strand, 42576117 - 42576062
Alignment:
| Q |
156 |
cctcgtcttgcatttagtgaacagggtgaagtttttagtctgaaagtaattcctaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42576117 |
cctcgtcttgcatttagtgaacagggtgaagtttttagcctgaaagtaattcctaa |
42576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 35272170 - 35272128
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35272170 |
tgacaacttcttttttctctctttttattggtcaaaaacaatg |
35272128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 8066497 - 8066456
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
8066497 |
tgacaacttatttttctctcttttcattggtcaaaaacaatg |
8066456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 550 - 590
Target Start/End: Complemental strand, 14207517 - 14207476
Alignment:
| Q |
550 |
gacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14207517 |
gacaacttcttttttctctctttttattggtcaaaaacaatg |
14207476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 550 - 590
Target Start/End: Complemental strand, 14215265 - 14215224
Alignment:
| Q |
550 |
gacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14215265 |
gacaacttcttttttctctctttttattggtcaaaaacaatg |
14215224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 874 - 914
Target Start/End: Complemental strand, 52082728 - 52082688
Alignment:
| Q |
874 |
ttattttaaaggagggatcaaaagtgaaaatgaaaattttt |
914 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
52082728 |
ttattttaaacgagggattaaaagtgaaaatgaaaattttt |
52082688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Original strand, 7149 - 7184
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7149 |
cttctttttctctttttttattggtcaaaaacaatg |
7184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 590
Target Start/End: Complemental strand, 32795980 - 32795937
Alignment:
| Q |
548 |
ttgacaactt-ctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
32795980 |
ttgacaactttcattttctctctttttattggtcaaaaacaatg |
32795937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 590
Target Start/End: Original strand, 39604173 - 39604216
Alignment:
| Q |
548 |
ttgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
39604173 |
ttgacaacttcttttttctctcttttcattggtcaaaaacaatg |
39604216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Complemental strand, 41717399 - 41717364
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41717399 |
cttctttttctctcttttcattggtcaaaaacaatg |
41717364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 9179155 - 9179114
Alignment:
| Q |
9 |
atccgatgtgggactaaataaccaccgagtgttggccgctaac |
51 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9179155 |
atccgatgtgggactaaatc-ccaccgagtgttggccgctaac |
9179114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 11173593 - 11173551
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
11173593 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
11173551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 19418088 - 19418130
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
19418088 |
tgacaacttcttttctctctcttttcattggtcaaaaacaatg |
19418130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 555 - 589
Target Start/End: Original strand, 26021994 - 26022028
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
26021994 |
cttctttttcactctttttattggtcaaaaacaat |
26022028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 36799541 - 36799499
Alignment:
| Q |
549 |
tgacaacttc-tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
36799541 |
tgacaacttcatttttctctcttttcattggtcaaaaacaatg |
36799499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 555 - 585
Target Start/End: Complemental strand, 37710540 - 37710510
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaa |
585 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37710540 |
cttctttttctctctttttattggtcaaaaa |
37710510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 46473271 - 46473229
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
46473271 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
46473229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 9 - 55
Target Start/End: Original strand, 48837090 - 48837135
Alignment:
| Q |
9 |
atccgatgtgggactaaataaccaccgagtgttggccgctaacaggt |
55 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
48837090 |
atccgatgtgggactaaatc-ccaccgagtgttggcagctaacaggt |
48837135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 556 - 589
Target Start/End: Original strand, 12762879 - 12762912
Alignment:
| Q |
556 |
ttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
12762879 |
ttctttttctctctttttattggtaaaaaacaat |
12762912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 560 - 589
Target Start/End: Complemental strand, 29525362 - 29525333
Alignment:
| Q |
560 |
ttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29525362 |
ttttctctctttttattggtcaaaaacaat |
29525333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 551 - 588
Target Start/End: Complemental strand, 36925875 - 36925838
Alignment:
| Q |
551 |
acaacttctttttctctctttttattggtcaaaaacaa |
588 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| |
|
|
| T |
36925875 |
acaacttcttttcctttctttttattggtcaaaaacaa |
36925838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 41309142 - 41309101
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||||| |||||| |||||| |||||||||| |
|
|
| T |
41309142 |
tgacaacttctttttctatcttttcattggttaaaaacaatg |
41309101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000002; HSPs: 15)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 549 - 589
Target Start/End: Complemental strand, 18949148 - 18949108
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18949148 |
tgacaacttctttttctttctttttattggtcaaaaacaat |
18949108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 45515528 - 45515569
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
45515528 |
tgacaacttctttttctctcttttcattggttaaaaacaatg |
45515569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 878 - 914
Target Start/End: Complemental strand, 31665967 - 31665931
Alignment:
| Q |
878 |
tttaaaggagggatcaaaagtgaaaatgaaaattttt |
914 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31665967 |
tttaaaggagggatcaaaagtgaagatgaaaattttt |
31665931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Complemental strand, 6365318 - 6365287
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6365318 |
tttttctctctttttattggtcaaaaacaatg |
6365287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Complemental strand, 30856943 - 30856908
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30856943 |
cttctttttctctcttttcattggtcaaaaacaatg |
30856908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 1889290 - 1889248
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
1889290 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
1889248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 3091884 - 3091842
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
3091884 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
3091842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 22390295 - 22390253
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
22390295 |
tgacaacttcttttctctctcttttcattggtcaaaaacaatg |
22390253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 559 - 589
Target Start/End: Complemental strand, 32128262 - 32128232
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32128262 |
tttttctctctttttattggtcaaaaacaat |
32128232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 34442256 - 34442214
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
34442256 |
tgacaacctcttttctctctctttttattggtcaaaaacaatg |
34442214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 19695620 - 19695661
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
19695620 |
tgacaactttttttcctctcttttcattggtcaaaaacaatg |
19695661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 589
Target Start/End: Original strand, 23344917 - 23344958
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
23344917 |
tgacaacttcttttctctctcttttcattggtcaaaaacaat |
23344958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 560 - 589
Target Start/End: Original strand, 25997670 - 25997699
Alignment:
| Q |
560 |
ttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25997670 |
ttttctctctttttattggtcaaaaacaat |
25997699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 555 - 588
Target Start/End: Original strand, 36763455 - 36763488
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaa |
588 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
36763455 |
cttctttttctctcttttcattggtcaaaaacaa |
36763488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 560 - 589
Target Start/End: Original strand, 43791731 - 43791760
Alignment:
| Q |
560 |
ttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43791731 |
ttttctctctttttattggtcaaaaacaat |
43791760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000009; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000009
Query Start/End: Original strand, 555 - 590
Target Start/End: Original strand, 36930691 - 36930726
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930691 |
cttctttttctctctttttattggtcaaaaacaatg |
36930726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 5477091 - 5477133
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5477091 |
tgacaacttcttttttctctctttttattggtcaaaaacaatg |
5477133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 556 - 590
Target Start/End: Complemental strand, 6841926 - 6841892
Alignment:
| Q |
556 |
ttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6841926 |
ttctttttctctctttttattggtcaaaaacaatg |
6841892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 558 - 590
Target Start/End: Complemental strand, 19651541 - 19651509
Alignment:
| Q |
558 |
ctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19651541 |
ctttttctctctttttattggtcaaaaacaatg |
19651509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Complemental strand, 4604665 - 4604630
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4604665 |
cttctttttctctcttttcattggtcaaaaacaatg |
4604630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Complemental strand, 25995592 - 25995561
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25995592 |
tttttctctctttttattggtcaaaaacaatg |
25995561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Complemental strand, 32966399 - 32966368
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32966399 |
tttttctctctttttattggtcaaaaacaatg |
32966368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Original strand, 42299123 - 42299158
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42299123 |
cttctttttctctctttttattggtcaaaaataatg |
42299158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Complemental strand, 45443242 - 45443200
Alignment:
| Q |
9 |
atccgatgtgggactaaataaccaccgagtgttggccgctaaca |
52 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45443242 |
atccgatgtgggactaaatc-ccaccgagtgttggccgctaaca |
45443200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Complemental strand, 49621497 - 49621462
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49621497 |
cttcattttctctctttttattggtcaaaaacaatg |
49621462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Original strand, 50527992 - 50528027
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50527992 |
cttctttttctctcttttcattggtcaaaaacaatg |
50528027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 40610372 - 40610330
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
40610372 |
tgacaacttcttttctctctcttttcattggtcaaaaacaatg |
40610330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 50659120 - 50659162
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
50659120 |
tgacaacttcttttctctctcttttcattggtcaaaaacaatg |
50659162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 559 - 589
Target Start/End: Complemental strand, 52715131 - 52715101
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52715131 |
tttttctctctttttattggtcaaaaacaat |
52715101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 31703409 - 31703450
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
31703409 |
tgacaacttttttttctctcttttcattggttaaaaacaatg |
31703450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000003; HSPs: 11)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 555 - 589
Target Start/End: Original strand, 3770959 - 3770993
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3770959 |
cttctttttctctctttttattggtcaaaaacaat |
3770993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Complemental strand, 8959292 - 8959261
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8959292 |
tttttctctctttttattggtcaaaaacaatg |
8959261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Original strand, 11464062 - 11464093
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11464062 |
tttttctctctttttattggtcaaaaacaatg |
11464093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 22196635 - 22196677
Alignment:
| Q |
9 |
atccgatgtgggactaaataaccaccgagtgttggccgctaaca |
52 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22196635 |
atccgatgtgggactaaatc-ccaccgagtgttggccgctaaca |
22196677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 19376060 - 19376102
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
19376060 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
19376102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 34381155 - 34381113
Alignment:
| Q |
549 |
tgacaacttc-tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
34381155 |
tgacaacttcgtttttctctcttttcattggtcaaaaacaatg |
34381113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 39595417 - 39595375
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
39595417 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
39595375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 658 - 691
Target Start/End: Original strand, 3723114 - 3723147
Alignment:
| Q |
658 |
ttgtaagaaagtagttgtacaaatatcatttctc |
691 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
3723114 |
ttgtaataaagtagttgtacaaatatcatttctc |
3723147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 555 - 588
Target Start/End: Complemental strand, 7144711 - 7144678
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaa |
588 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
7144711 |
cttctttttctctctttttattggtcaataacaa |
7144678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 50
Target Start/End: Original strand, 22196408 - 22196448
Alignment:
| Q |
9 |
atccgatgtgggactaaataaccaccgagtgttggccgctaa |
50 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22196408 |
atccgatgtgggactaaatc-ccaccgagtgttggccgctaa |
22196448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 550 - 590
Target Start/End: Complemental strand, 42909861 - 42909820
Alignment:
| Q |
550 |
gacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
42909861 |
gacaacttcttttctctctcttttcattggtcaaaaacaatg |
42909820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000003; HSPs: 22)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 555 - 589
Target Start/End: Complemental strand, 8456039 - 8456005
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8456039 |
cttctttttctctctttttattggtcaaaaacaat |
8456005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 49195026 - 49194984
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49195026 |
tgacaacttcttttctctctctttttattggtcaaaaacaatg |
49194984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 549 - 589
Target Start/End: Complemental strand, 39449313 - 39449272
Alignment:
| Q |
549 |
tgacaact-tctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39449313 |
tgacaactctctttttctctctttttattggtcaaaaacaat |
39449272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 551 - 590
Target Start/End: Original strand, 39844188 - 39844228
Alignment:
| Q |
551 |
acaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39844188 |
acaacttcttttttctctctttttattggtcaaaaacaatg |
39844228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Complemental strand, 3223125 - 3223090
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3223125 |
cttctttttctctcttcttattggtcaaaaacaatg |
3223090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Original strand, 5234410 - 5234441
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5234410 |
tttttctctctttttattggtcaaaaacaatg |
5234441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Original strand, 28676089 - 28676124
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28676089 |
cttctttttctctcttttcattggtcaaaaacaatg |
28676124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Original strand, 32365606 - 32365637
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32365606 |
tttttctctctttttattggtcaaaaacaatg |
32365637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Complemental strand, 32901461 - 32901430
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32901461 |
tttttctctctttttattggtcaaaaacaatg |
32901430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 52810934 - 52810976
Alignment:
| Q |
9 |
atccgatgtgggactaaataaccaccgagtgttggccgctaaca |
52 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52810934 |
atccgatgtgggactaaatc-ccaccgagtgttggccgctaaca |
52810976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 9162209 - 9162167
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
9162209 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
9162167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 555 - 589
Target Start/End: Original strand, 25241812 - 25241846
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
25241812 |
cttctttttctctctttttatttgtcaaaaacaat |
25241846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 555 - 589
Target Start/End: Complemental strand, 33438181 - 33438147
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
33438181 |
cttcattttctctctttttattggtcaaaaacaat |
33438147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 555 - 589
Target Start/End: Original strand, 33575009 - 33575043
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33575009 |
cttctttttctctttttttattggtcaaaaacaat |
33575043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 53
Target Start/End: Complemental strand, 33912063 - 33912022
Alignment:
| Q |
11 |
ccgatgtgggactaaataaccaccgagtgttggccgctaacag |
53 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33912063 |
ccgatgtgggactaaatc-ccaccgagtgttggccgctaacag |
33912022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 36512985 - 36512943
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
36512985 |
tgacaacttcttttctctctctttttattggtaaaaaacaatg |
36512943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 560 - 589
Target Start/End: Original strand, 839410 - 839439
Alignment:
| Q |
560 |
ttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
839410 |
ttttctctctttttattggtcaaaaacaat |
839439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 16004255 - 16004296
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
16004255 |
tgacaacttttttttctctcttttcattggtcaaaaataatg |
16004296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 589
Target Start/End: Complemental strand, 24772814 - 24772773
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24772814 |
tgacaatttcttttctctctctttttattggtcaaaaacaat |
24772773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 553 - 586
Target Start/End: Complemental strand, 34259964 - 34259931
Alignment:
| Q |
553 |
aacttctttttctctctttttattggtcaaaaac |
586 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
34259964 |
aacttctttttctctcttcttattggtcaaaaac |
34259931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 48099952 - 48099911
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
48099952 |
tgacaacttttttttttctctttttattggttaaaaacaatg |
48099911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 53384270 - 53384311
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
53384270 |
tgacaatttgtttttctctcttcttattggtcaaaaacaatg |
53384311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.000000001; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 7596820 - 7596861
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
7596820 |
tgacaatttctttttctatctttttattggtcaaaaacaatg |
7596861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 41293650 - 41293691
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
41293650 |
tgacaacttgtttttctctcttcttattggtcaaaaacaatg |
41293691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Complemental strand, 5359470 - 5359439
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5359470 |
tttttctctctttttattggtcaaaaacaatg |
5359439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Complemental strand, 33817289 - 33817258
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33817289 |
tttttctctctttttattggtcaaaaacaatg |
33817258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 426244 - 426202
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
426244 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
426202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 22767273 - 22767231
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
22767273 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
22767231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 23258175 - 23258133
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23258175 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
23258133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 28927824 - 28927782
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
28927824 |
tgacaacttcttttctctctcttttcattggtcaaaaacaatg |
28927782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 53
Target Start/End: Complemental strand, 35908698 - 35908657
Alignment:
| Q |
11 |
ccgatgtgggactaaataaccaccgagtgttggccgctaacag |
53 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35908698 |
ccgatgtgggactaaatc-ccaccgagtgttggccgctaacag |
35908657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 559 - 589
Target Start/End: Complemental strand, 36015689 - 36015659
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36015689 |
tttttctctctttttattggtcaaaaacaat |
36015659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 560 - 589
Target Start/End: Complemental strand, 154421 - 154392
Alignment:
| Q |
560 |
ttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
154421 |
ttttctctctttttattggtcaaaaacaat |
154392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 589
Target Start/End: Complemental strand, 24503060 - 24503019
Alignment:
| Q |
549 |
tgacaacttc-tttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
24503060 |
tgacaacttcatttttctctcttttcattggtcaaaaacaat |
24503019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 30925583 - 30925624
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
30925583 |
tgacaacttttttttctctcttttcattggttaaaaacaatg |
30925624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 560 - 589
Target Start/End: Complemental strand, 42026503 - 42026474
Alignment:
| Q |
560 |
ttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42026503 |
ttttctctctttttattggtcaaaaacaat |
42026474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 589
Target Start/End: Complemental strand, 44068814 - 44068773
Alignment:
| Q |
549 |
tgacaacttc-tttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
44068814 |
tgacaacttcctttttctctctttctattggtcaaaaacaat |
44068773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.000000001; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 22491958 - 22491999
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
22491958 |
tgacaacttctttttctctcttttgattggtcaaaagcaatg |
22491999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 548 - 590
Target Start/End: Original strand, 1688300 - 1688343
Alignment:
| Q |
548 |
ttgacaacttctttttc-tctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
1688300 |
ttgacaacttctttttcctctctttttattggttaaaaacaatg |
1688343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Original strand, 3660292 - 3660323
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3660292 |
tttttctctctttttattggtcaaaaacaatg |
3660323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 559 - 589
Target Start/End: Original strand, 3339438 - 3339468
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3339438 |
tttttctctctttttattggtcaaaaacaat |
3339468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 29383700 - 29383658
Alignment:
| Q |
549 |
tgacaacttcttttt-ctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
29383700 |
tgacaacttcttttttctctcttttcattggtcaaaaacaatg |
29383658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 556 - 589
Target Start/End: Complemental strand, 2340533 - 2340500
Alignment:
| Q |
556 |
ttctttttctctctttttattggtcaaaaacaat |
589 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
2340533 |
ttctttttctctctttttattggtcgaaaacaat |
2340500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 658 - 691
Target Start/End: Complemental strand, 30622057 - 30622024
Alignment:
| Q |
658 |
ttgtaagaaagtagttgtacaaatatcatttctc |
691 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
30622057 |
ttgtaataaagtagttgtacaaatatcatttctc |
30622024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Original strand, 17265 - 17300
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17265 |
cttctttttctctttttttattggtcaaaaacaatg |
17300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000002; HSPs: 11)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Original strand, 10014894 - 10014925
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10014894 |
tttttctctctttttattggtcaaaaacaatg |
10014925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 555 - 590
Target Start/End: Complemental strand, 29034221 - 29034186
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29034221 |
cttctttttctctcttttcattggtcaaaaacaatg |
29034186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 559 - 590
Target Start/End: Original strand, 37351929 - 37351960
Alignment:
| Q |
559 |
tttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37351929 |
tttttctctctttttattggtcaaaaacaatg |
37351960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 39550060 - 39550102
Alignment:
| Q |
9 |
atccgatgtgggactaaataaccaccgagtgttggccgctaaca |
52 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39550060 |
atccgatgtgggactaaatc-ccaccgagtgttggccgctaaca |
39550102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 2790320 - 2790278
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
2790320 |
tgacaacttcttttctctctcttttcattggtcaaaaacaatg |
2790278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 5978722 - 5978680
Alignment:
| Q |
549 |
tgacaacttct-ttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
5978722 |
tgacaacttctattttctctcttttcattggtcaaaaacaatg |
5978680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 33223457 - 33223499
Alignment:
| Q |
549 |
tgacaacttctttttc-tctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33223457 |
tgacaacttctttttcctctctttttattggccaaaaacaatg |
33223499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 46651815 - 46651773
Alignment:
| Q |
549 |
tgacaacttct-ttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
46651815 |
tgacaacttctattttctctcttttcattggtcaaaaacaatg |
46651773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 7390703 - 7390744
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| |||| |
|
|
| T |
7390703 |
tgacaacttctttttctctctttttattgattaaaaataatg |
7390744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 555 - 588
Target Start/End: Original strand, 12232938 - 12232971
Alignment:
| Q |
555 |
cttctttttctctctttttattggtcaaaaacaa |
588 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
12232938 |
cttctttttctctctatttattggtcaaaaacaa |
12232971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 557 - 590
Target Start/End: Original strand, 49014336 - 49014369
Alignment:
| Q |
557 |
tctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
49014336 |
tctttttctctatttttattggtcaaaaacaatg |
49014369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 219592 - 219634
Alignment:
| Q |
549 |
tgacaacttctttt-tctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
219592 |
tgacaacttcttttctctctcttttcattggtcaaaaacaatg |
219634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 556 - 590
Target Start/End: Complemental strand, 337253 - 337219
Alignment:
| Q |
556 |
ttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
337253 |
ttctttttctctttttttattggtcaaaaacaatg |
337219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0115 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Original strand, 15117 - 15158
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |||||||||| |
|
|
| T |
15117 |
tgacaacttctttttctcttttttcattggttaaaaacaatg |
15158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 549 - 590
Target Start/End: Complemental strand, 18146 - 18105
Alignment:
| Q |
549 |
tgacaacttctttttctctctttttattggtcaaaaacaatg |
590 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
18146 |
tgacaacttttttttctctcttttcattggttaaaaacaatg |
18105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University