View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4786-Insertion-6 (Length: 430)
Name: NF4786-Insertion-6
Description: NF4786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4786-Insertion-6 |
 |  |
|
| [»] chr3 (53 HSPs) |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
| [»] scaffold0316 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0209 (1 HSPs) |
 |  |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold0341 (1 HSPs) |
 |  |  |
|
| [»] scaffold0384 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (2 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0079 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 53)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 236 - 430
Target Start/End: Complemental strand, 40660312 - 40660118
Alignment:
| Q |
236 |
cggattgtagcctatagaggaggttatcacccgggttttgatagtaaatttaaaatgttggtataatgaaaaaatatacttaattaacagatagatattt |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40660312 |
cggattgtagcctatagaggaggttatcacccgggttttgatagtaaatttaaaatgttggtataatgaaaaaatatacttaattaacagataaatattt |
40660213 |
T |
 |
| Q |
336 |
tgagtgcatgcacctgatcatgatggtcatcgtggatgacatgctgcaaatccaactgtgcctgggcttttgtggattcataacgcgatgatgat |
430 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660212 |
tgagtgcatgcacctgatcatgatggtcatcgtggatgacatgctgcaaatccaactgtgcctgggcttttgtggattcataacgcgatgatgat |
40660118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 7 - 204
Target Start/End: Complemental strand, 40660544 - 40660332
Alignment:
| Q |
7 |
agttacaacatgcaattcttcactccctaggctcattagaagtaaagaaactgaaccaagttgtttggactctagtgacaaggagct------------- |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
40660544 |
agttacaacatgcaattcttcactccctaggctgattagaagtaaagaaatagaaccaaattgttcagactctagtgacaagaagctccttctaaagagt |
40660445 |
T |
 |
| Q |
94 |
-atctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagat |
191 |
Q |
| |
|
||| | ||||||||| ||||||| |||||||||||||| ||||| ||||||||||||||||||||||||| | ||||| |||||||||||| || | | |
|
|
| T |
40660444 |
tatccgggaaataccggattcgattcctaggaggaacaacatttggtcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggt |
40660345 |
T |
 |
| Q |
192 |
cgaaaaccggtgc |
204 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40660344 |
cgaaaaccggtgc |
40660332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 54261225 - 54261328
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||||||| | ||| |||||| |
|
|
| T |
54261225 |
aataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccg |
54261324 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
54261325 |
gtgc |
54261328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 49198350 - 49198411
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49198350 |
aataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatga |
49198411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 184
Target Start/End: Original strand, 30045820 - 30045903
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| |||||||||||||||| ||||||||| || || |||||||| | ||||||| |
|
|
| T |
30045820 |
aataccgggttcgattcctagggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctgattagtcgtccaccttt |
30045903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 35923731 - 35923628
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcg-attagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||||||||||||||||||||||||| ||| || ||| ||||||| | || |||| | |||||||||||| |
|
|
| T |
35923731 |
aataccaggttcgattcatagggggaacaacgtttggccagtgcgcatgcctctaagcacgagtcgaattagtcgtccatctttgatggatcgaaaaccg |
35923632 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
35923631 |
gtgc |
35923628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 48342019 - 48342122
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||||| ||||| |||||||||||||||||||||||| | |||||||| | || |||| || ||||| |||| | |
|
|
| T |
48342019 |
aataccgggttctattcctagggggaacaacgcttggctagtgcgcatgcctctacgcatgaaccagattagtcgtccatctttggtggatcggaaacag |
48342118 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
48342119 |
gtgc |
48342122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 15320185 - 15320243
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
15320185 |
aataccgggttcgatttcgaggaggaacaatgattggccagtgtgcatgcctctacgca |
15320243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 10855382 - 10855441
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
10855382 |
aaataccgggtttgatttccagggggaacaacgcttggccagtacgcatgcctctacgca |
10855441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 8164552 - 8164610
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||| ||||||| | ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
8164552 |
aataccgggttcaatttctaaggggaacaacgcttggccagtgcgcatgcctttacgca |
8164610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 47749212 - 47749155
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
47749212 |
aataccgggttcgattcctagg-ggaacaactcttggccagtgcgcatgcctctacgca |
47749155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 3755569 - 3755630
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||| ||||||| | ||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
3755569 |
aataccgacttcgattcccaggaggaacaacgtttgaccagtgcgcatgtctctacgcatga |
3755630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 6462411 - 6462472
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6462411 |
aataccgggttcgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatga |
6462472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 28242277 - 28242338
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| |||| | ||||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
28242277 |
aataccgggttagattgccaggaggaacaatgtttggccagtgcacatgcctctatgcatga |
28242338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 29135912 - 29135973
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29135912 |
aataccggattcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
29135973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 33251661 - 33251722
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33251661 |
aataccgggttcgattcccggtgggaacaacgtttggccagtgtgcatgcctctacgcatga |
33251722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 35315955 - 35316016
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35315955 |
aatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
35316016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 45877453 - 45877514
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| ||| | |||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
45877453 |
aataccgggttcgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatga |
45877514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 7328842 - 7328945
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaacc |
199 |
Q |
| |
|
||||||||||||||||| | ||| |||||||| ||||||||||||||||||| ||||||||| | |||||||| ||||||| || | ||||||||| |
|
|
| T |
7328842 |
aaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggtgggtcgaaaacc |
7328940 |
T |
 |
| Q |
200 |
ggtgc |
204 |
Q |
| |
|
||||| |
|
|
| T |
7328941 |
ggtgc |
7328945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 163
Target Start/End: Original strand, 26043812 - 26043872
Alignment:
| Q |
103 |
ataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||| | ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26043812 |
ataccgggttcgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatga |
26043872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 3136801 - 3136699
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||| |||||||| ||| |||||||| |||| |||||||||||||||||||||||| || |||||||| | ||||||| || | ||| |||||| |
|
|
| T |
3136801 |
aataccggattcgattttcagg-ggaacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccg |
3136703 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
3136702 |
gtgc |
3136699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 3507641 - 3507538
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||||||||| |||| |||| |||||||| |||||||||||||||||||||||||| || | |||||||| |||||||| || | ||| |||||| |
|
|
| T |
3507641 |
aataccgggtttgattcctagagggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccg |
3507542 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
3507541 |
gtgc |
3507538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 8362576 - 8362679
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||| ||| | || | ||||||||||||||||| ||||||||||||||||||| | ||||||| | |||||||||| |||| |||||| |
|
|
| T |
8362576 |
aataccgggttcaattcccagtggaaacaacgtttggccagtccgcatgcctctacgcatgagccaaattagtcgtccacctttagtggatccgaaaccg |
8362675 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
8362676 |
gtgc |
8362679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 13893925 - 13894028
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||| |||| || ||||||||||||||| || || | |||||||| ||||||| || |||||||||||| |
|
|
| T |
13893925 |
aataccgggttggatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacctttggtggatcgaaaaccg |
13894024 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
13894025 |
gtgc |
13894028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 30767355 - 30767297
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
30767355 |
aatatcgggttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgca |
30767297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 31072877 - 31072935
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
31072877 |
aataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgca |
31072935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 187
Target Start/End: Complemental strand, 45402459 - 45402373
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagt |
187 |
Q |
| |
|
|||| ||||||||||| |||| |||||||| | |||| |||||||||||||||||||||| | |||||||| |||||||||||| |
|
|
| T |
45402459 |
aatatcgggttcgattcctagagggaacaacactcggcctgtgcgcatgcctctacgcatgagccggattagtcgttcacctttagt |
45402373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 52364908 - 52364850
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||| | || |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
52364908 |
aataccgagttcgattcccagaaggaacaacgcttgaccagtgcgcatgcctctacgca |
52364850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 26207909 - 26207848
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | | | ||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
26207909 |
aataccgggttcgattcccacggggaacaacgcttgtccagtgtgcatgcctctacgcatga |
26207848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 29127918 - 29127979
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29127918 |
aatatcgggttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatga |
29127979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 42412882 - 42412821
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | || ||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
42412882 |
aataccgggttcgattcccggggggaacaacgcttggcaagtgcccatgcctctacgcatga |
42412821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 198
Target Start/End: Original strand, 49082823 - 49082920
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaac |
198 |
Q |
| |
|
||||||| |||||||| | ||| |||||||| || |||||||||||||| ||||| || ||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
49082823 |
aataccgagttcgattcccagggagaacaacgcttagccagtgcgcatgcatctacacacgaatcagattagtcacccacctttaatggatcgaaaac |
49082920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 204
Target Start/End: Original strand, 23511593 - 23511669
Alignment:
| Q |
129 |
caacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || ||||| || | ||||||| | | |||||||||||||| |
|
|
| T |
23511593 |
caacgtttgaccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccggtgc |
23511669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 39849091 - 39849131
Alignment:
| Q |
123 |
gaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
39849091 |
gaggaacaacgcttggccagtgtgcatgcctctacgcatga |
39849131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 204
Target Start/End: Original strand, 41219610 - 41219694
Alignment:
| Q |
121 |
aggaggaacaacgtttggccagtgcgcatgcctctacgcatga-atcgattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||| || | ||||| ||| |||||||| || ||||| ||||| |||| |
|
|
| T |
41219610 |
aggaggaacaacgtttggccagtgcgtatgcctctgcgcacgagctggattaatcactcacctttggtggatcgtaaaccagtgc |
41219694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 160
Target Start/End: Original strand, 10040578 - 10040613
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10040578 |
ggaacaacgcttggccagtgcgcatgcctctacgca |
10040613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 98 - 204
Target Start/End: Complemental strand, 20948173 - 20948066
Alignment:
| Q |
98 |
gaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaa |
196 |
Q |
| |
|
||||||||| |||||||||| | | |||||||| |||| |||||| ||||||||||| ||| ||| |||||||| |||||| || ||||||||||| |
|
|
| T |
20948173 |
gaaaaatactgggttcgattaccaaagggaacaacatttgaccagtgtgcatgcctctatgcacgaacgagattagtcgttcaccgttggtagatcgaaa |
20948074 |
T |
 |
| Q |
197 |
accggtgc |
204 |
Q |
| |
|
| |||||| |
|
|
| T |
20948073 |
atcggtgc |
20948066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 200
Target Start/End: Complemental strand, 34662427 - 34662328
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcg-attagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||| |||||||||||| |||||||| ||||||||| |||| |||||| ||||| |||||| || ||||||| | |||||||||| ||| | |||||| |
|
|
| T |
34662427 |
aatatcgggttcgattttcaggaggaataacgtttggtcagtacgcatgtctctatgcatgagccgaattagtcgtccacctttagtggattggaaaccg |
34662328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 163
Target Start/End: Complemental strand, 41630622 - 41630559
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||| ||| | | | ||||||||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
41630622 |
aaaataccgggttcaattcccaaggggaacaacgcttgcccagtgcgcatgcctctacacatga |
41630559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 51060389 - 51060286
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaa-tcgattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||| ||||||||||| ||| |||||||| |||| ||||||||||||||||||||||||| | |||||||| | |||| || || | ||| |||||| |
|
|
| T |
51060389 |
aatatcgggttcgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccg |
51060290 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
51060289 |
gtgc |
51060286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 53649726 - 53649829
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||||||||||| || |||||||||||| | |||||||| ||||||||| | ||||| |||||| |
|
|
| T |
53649726 |
aataccgggttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcacctttgatggatcggaaaccg |
53649825 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
53649826 |
gtgc |
53649829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 160
Target Start/End: Complemental strand, 55069764 - 55069729
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55069764 |
ggaacaacgtttggccagtgcacatgcctctacgca |
55069729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 7650226 - 7650284
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||| || ||| ||||||||| |
|
|
| T |
7650226 |
aataccgggttcgatttccagggggaacaacacttggccagtacgaatgtctctacgca |
7650284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 175
Target Start/End: Complemental strand, 11687217 - 11687143
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtca |
175 |
Q |
| |
|
||||||||||| |||| ||| ||||||| | |||||||||||||||||||||||| |||| || ||||||||| |
|
|
| T |
11687217 |
aataccgggtttgattctcagggggaacaatgcttggccagtgcgcatgcctctacgtatgagtcagattagtca |
11687143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 15795601 - 15795544
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||| | ||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
15795601 |
aataccgagttcgattcccagg-ggaacaacgcttggtcagtgcgcatgcctctacgca |
15795544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 41223121 - 41223087
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41223121 |
aacaacgtttggccaatgcgcatgcctctacgcat |
41223087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 32873657 - 32873596
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||| ||| ||||||| |||||||||||| |||| |
|
|
| T |
32873657 |
aataccaggttcgattcctagggagaacaacgcttgaccagtgcacatgcctctacgtatga |
32873596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 33688950 - 33689011
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||| ||| ||| | |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
33688950 |
aatatcgggttcaattcctaaggggaataacacttggccagtgcgcatgcctctacgcatga |
33689011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 47219143 - 47219204
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| ||||||||| | | | | ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
47219143 |
aataccaggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatga |
47219204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 47471831 - 47471891
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| ||||||| | ||||| ||||||||||| ||||||||||| |
|
|
| T |
47471831 |
aataccgggttcgattcccagg-ggaacaatgcttggctagtgcgcatgcttctacgcatga |
47471891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 51683062 - 51683009
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctct |
155 |
Q |
| |
|
|||||| ||||||||| | ||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
51683062 |
aataccaggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctct |
51683009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 50405705 - 50405653
Alignment:
| Q |
108 |
gggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||| | ||| | ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
50405705 |
gggttcgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgca |
50405653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 108 - 148
Target Start/End: Original strand, 50682482 - 50682522
Alignment:
| Q |
108 |
gggttcgatttctaggaggaacaacgtttggccagtgcgca |
148 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
50682482 |
gggttcgatttctagggagaacaacgcttggccagtgcgca |
50682522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 47)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 43862079 - 43861976
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| || |||||||||||| |
|
|
| T |
43862079 |
aataccgggttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcattcacctttggtggatcgaaaaccg |
43861980 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
43861979 |
gtgc |
43861976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 18785671 - 18785774
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaa-tcgattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||| | |||||||| ||||||| | || | ||| |||||| |
|
|
| T |
18785671 |
aataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggtgggtcggaaaccg |
18785770 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
18785771 |
gtgc |
18785774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 4195309 - 4195248
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||| |||||||||| |||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
4195309 |
aataccgagttcgatttccaggaggaacaacatttggctagtgcgcatgcctctacgcatga |
4195248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 5039525 - 5039422
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||| |||||| ||| ||||||||||||| | |||||||| |||||||| || |||||||||||| |
|
|
| T |
5039525 |
aataccgagttcgattcctaggaggaacaacacttggtcagtgcacatacctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccg |
5039426 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
5039425 |
gtgc |
5039422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 27875195 - 27875092
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcg-attagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||| ||||||| | ||| |||| ||| ||||||||||| ||||||||||||||||| ||| ||||||| | |||||||||| | |||||||||| |
|
|
| T |
27875195 |
aataccggattcgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccg |
27875096 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
27875095 |
gtgc |
27875092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 21190887 - 21190829
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
21190887 |
aataccgggttcgattcctaggaggagcaacgcttggctagtgcgcatgcctctacgca |
21190829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 103 - 204
Target Start/End: Original strand, 39474943 - 39475045
Alignment:
| Q |
103 |
ataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccgg |
201 |
Q |
| |
|
||||||||||||||| ||| | ||||||||| |||| |||||||||| ||||||||||||| | |||||||| | |||||||||| | ||||||||| | |
|
|
| T |
39474943 |
ataccgggttcgattcctatggggaacaacgcttggtcagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaaccag |
39475042 |
T |
 |
| Q |
202 |
tgc |
204 |
Q |
| |
|
||| |
|
|
| T |
39475043 |
tgc |
39475045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 38578974 - 38578913
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38578974 |
aatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatga |
38578913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 17748489 - 17748433
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacg |
158 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
17748489 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacg |
17748433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 27028280 - 27028384
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga-atcgattagtcattcacctttagtagatcgaaaacc |
199 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||| ||||||||||||||||||||||| ||||| | |||||||| |||||||| || | ||| ||||| |
|
|
| T |
27028280 |
aaataccaggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaacc |
27028379 |
T |
 |
| Q |
200 |
ggtgc |
204 |
Q |
| |
|
||||| |
|
|
| T |
27028380 |
ggtgc |
27028384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 5069923 - 5069864
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || || |||| ||||||||||||||| |
|
|
| T |
5069923 |
aaataccgggttcgatttccaggaggaacaacgcttagctagtgtgcatgcctctacgca |
5069864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 13095860 - 13095963
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||| ||| | ||| |||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||| || | ||| |||||| |
|
|
| T |
13095860 |
aataccgggttctattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccg |
13095959 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
13095960 |
gtgc |
13095963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 184
Target Start/End: Complemental strand, 22993474 - 22993391
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||| ||||||||||| | ||||||||||||| |||||||||| ||||||||||||||| ||| | |||||||| |||||||| |
|
|
| T |
22993474 |
aatatcgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcaccttt |
22993391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 29151942 - 29151997
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
29151942 |
aataccgggttcgattcccaggaagaacaacgtttgaccagtgcgcatgcctctac |
29151997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 16802125 - 16802183
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||| ||||||| |||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
16802125 |
aataccggattcgattcttaggaggaacaacgattggccagtgcgtatgcctctacgca |
16802183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 49142776 - 49142718
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| || |||||||| |||||||||||||| |
|
|
| T |
49142776 |
aataccgggttcgattcctagggggaacaacgcttagccagtgcacatgcctctacgca |
49142718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 10047983 - 10047922
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10047983 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatga |
10047922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 43925514 - 43925575
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
43925514 |
aataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatga |
43925575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 48804685 - 48804746
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | | | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48804685 |
aataccgggttcgattcccaaggggaacaacacttggccagtgcgcatgcctctacgcatga |
48804746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 109 - 200
Target Start/End: Complemental strand, 4706084 - 4705992
Alignment:
| Q |
109 |
ggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga-atcgattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||| |||| |||||||||||| |||| | ||||||| |||||||| || | |||||||| | ||||||| ||||||||||||||| |
|
|
| T |
4706084 |
ggttcgatttttagggggaacaacgtttagccattacgcatgcttctacgcacgagctggattagtcgtccacctttggtagatcgaaaaccg |
4705992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 1605943 - 1606046
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||| ||||||||||| |||||||||| || ||| | |||||||| ||||||| || ||||| |||||| |
|
|
| T |
1605943 |
aatacctggttcgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggattagtcgcccacctttggtggatcggaaaccg |
1606042 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
1606043 |
gtgc |
1606046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 48244463 - 48244360
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||| ||||||| | ||||||| | ||| ||||||| ||||||||||||||| | |||||||| |||||||| || |||||||||||| |
|
|
| T |
48244463 |
aataccgggttcaatttctaaggggaacaatgcttgatcagtgcgtttgcctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccg |
48244364 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
48244363 |
gtgc |
48244360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 1797462 - 1797520
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| | ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
1797462 |
aataccgggttcgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgca |
1797520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 93 - 158
Target Start/End: Complemental strand, 24969440 - 24969377
Alignment:
| Q |
93 |
tatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacg |
158 |
Q |
| |
|
|||||| |||||||||||||||||||| || |||||||| ||||||||||||| |||||||||| |
|
|
| T |
24969440 |
tatctggaaaataccgggttcgatttccag--ggaacaacacttggccagtgcgcgtgcctctacg |
24969377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 47341878 - 47341936
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||| | ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
47341878 |
aataccgagttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgca |
47341936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 365142 - 365203
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
365142 |
aataccgggttcgattcacaggaggaacaacgcttaatcagtgcgcatgcctctacgcatga |
365203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 14650319 - 14650380
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| | ||| ||||||| |||||||||||||||| |
|
|
| T |
14650319 |
aatatcgggttcgatttccaggaggaacaatgcttgaccagtgcatatgcctctacgcatga |
14650380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 22973969 - 22974030
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
22973969 |
aataccgggttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatga |
22974030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 36619361 - 36619300
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
36619361 |
aataccgggttcgattcccagggggaacaacacttgtccagtgtgcatgcctctacgcatga |
36619300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 127 - 160
Target Start/End: Complemental strand, 42210344 - 42210311
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42210344 |
aacaacgtttggccagtgcgcatgcctctacgca |
42210311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 22268136 - 22268088
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatg |
150 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||| |
|
|
| T |
22268136 |
aataccgggttcgattcccagggggaacaacatttggccagtgcgcatg |
22268088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 124 - 163
Target Start/End: Complemental strand, 4228839 - 4228800
Alignment:
| Q |
124 |
aggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
4228839 |
aggaacaacgtttggccagtgcacatgcccctacgcatga |
4228800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 124 - 163
Target Start/End: Complemental strand, 19914788 - 19914749
Alignment:
| Q |
124 |
aggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19914788 |
aggaacaacgcttggccaatgcgcatgcctctacgcatga |
19914749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 157
Target Start/End: Original strand, 23658189 - 23658236
Alignment:
| Q |
110 |
gttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||| |||||||||||| |
|
|
| T |
23658189 |
gttcgatttccagggggaacaacgcttggccagtgtgcatgcctctac |
23658236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 184
Target Start/End: Complemental strand, 26423394 - 26423311
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||||||||||||||| | ||| | ||||||| ||||||||||| | |||||||||||| || | |||||||| ||||||||| |
|
|
| T |
26423394 |
aataccgggttcgattcccaggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcaccttt |
26423311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 34659228 - 34659286
Alignment:
| Q |
102 |
aataccgggttcgatt-tctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| || ||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34659228 |
aataccgggttcgattctcaagg-ggaacaacgcttgaccagtgcgcatgcctctacgca |
34659286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 10317852 - 10317750
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcgattagtcattcacctttagtagatcgaaaaccgg |
201 |
Q |
| |
|
|||||||||||||||| | ||| |||| ||| |||| ||||||| ||||||||| |||| | |||||||| |||||||| || ||||| ||||||| |
|
|
| T |
10317852 |
aataccgggttcgattcccagggggaataacacttggtcagtgcgtatgcctctatgcataagcagattagtcgctcacctttggtggatcggaaaccgg |
10317753 |
T |
 |
| Q |
202 |
tgc |
204 |
Q |
| |
|
||| |
|
|
| T |
10317752 |
tgc |
10317750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 163
Target Start/End: Complemental strand, 29805524 - 29805486
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
29805524 |
ggaacaacgtttggtcagtgcgcatgtctctacgcatga |
29805486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 37514923 - 37514981
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
37514923 |
aatactgggttcgattttcagtgggaacaacgtttggtcagtgcgcatgtctctacgca |
37514981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 163
Target Start/End: Original strand, 39420862 - 39420900
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
39420862 |
ggaacaacgcttggccagtgcgcgtgcctctacgcatga |
39420900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 160
Target Start/End: Original strand, 44336903 - 44336953
Alignment:
| Q |
110 |
gttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||| |||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
44336903 |
gttcgatttccaggaaaaataacgtttggtcagtgcgcatgcctctacgca |
44336953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 160
Target Start/End: Original strand, 3353451 - 3353484
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
3353451 |
aacaacatttggccagtgcgcatgcctctacgca |
3353484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 3603355 - 3603417
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggc----cagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3603355 |
aataccgggttcgattctttgggggaacaacgtttggccggtcagtgcgcatgcctctacgca |
3603417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 60 - 93
Target Start/End: Original strand, 14650263 - 14650296
Alignment:
| Q |
60 |
aaccaagttgtttggactctagtgacaaggagct |
93 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
14650263 |
aaccaagttgtttggactctagtggcaaggagct |
14650296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 22573815 - 22573875
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| |||||||||||| ||| |||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
22573815 |
aatatcgggttcgattttcagg-ggaacaacatttgaccagtgcgcatgcctttacgcatga |
22573875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 42032098 - 42032159
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| ||||||||| | | | ||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
42032098 |
aatacctggttcgattcccacggggaacaacgtttggccagtgcacatacatctacgcatga |
42032159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 101 - 201
Target Start/End: Original strand, 45447971 - 45448072
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaacc |
199 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||| ||||| ||||||||| ||||||| || | || ||||||||| |||||||||| | ||| ||||| |
|
|
| T |
45447971 |
aaataccaggttcgatttccagggagaacaacgcttggctagtgcgcatccctctacacactagtcagattagtcacccacctttagtgggtcggaaacc |
45448070 |
T |
 |
| Q |
200 |
gg |
201 |
Q |
| |
|
|| |
|
|
| T |
45448071 |
gg |
45448072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 8e-28; HSPs: 51)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 53599064 - 53599167
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| | ||||| || |||||||||||| ||||| |||||| |
|
|
| T |
53599064 |
aataccgggttcgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttagtggatcggaaaccg |
53599163 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
53599164 |
gtgc |
53599167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 101 - 204
Target Start/End: Complemental strand, 42722685 - 42722581
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaacc |
199 |
Q |
| |
|
||||||||||||| ||| | ||||||||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||||||| | ||||||||| |
|
|
| T |
42722685 |
aaataccgggttcaattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgaaaacc |
42722586 |
T |
 |
| Q |
200 |
ggtgc |
204 |
Q |
| |
|
||||| |
|
|
| T |
42722585 |
ggtgc |
42722581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 2559311 - 2559369
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2559311 |
aataccggattcgatttctaggaggaacaacgcttggccagtgcgcatgcctctacgca |
2559369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 20532516 - 20532455
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20532516 |
aataccgagttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcatga |
20532455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 21429305 - 21429408
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||| ||||||||||||||||||||||| || || || ||||| | ||||||| || | ||| |||||| |
|
|
| T |
21429305 |
aatatcgggttcgatttttagggggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccg |
21429404 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
21429405 |
gtgc |
21429408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 38168261 - 38168363
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||||| ||||||||||| ||||||||||||||||| | |||||||| |||||||||||| | | | |||||| |
|
|
| T |
38168261 |
aataccaggttcgattcctaagaggaacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcacctttagtgggttggaaaccg |
38168359 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
38168360 |
gtgc |
38168363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 3159576 - 3159518
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3159576 |
aataccgggttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgca |
3159518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 1446830 - 1446891
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1446830 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
1446891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 7246753 - 7246692
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| |||||||||| |||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7246753 |
aatactgggttcgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatga |
7246692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 15840041 - 15839981
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| |||| || || |||||||||||||||||||||||||||||||||| |
|
|
| T |
15840041 |
aataccgggttcgattcctagaag-aataacgtttggccagtgcgcatgcctctacgcatga |
15839981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 108 - 204
Target Start/End: Original strand, 16450310 - 16450407
Alignment:
| Q |
108 |
gggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
|||||||||| | ||| ||||||||| ||||||||||| ||||||||||||||||| | |||||||| | ||||||| |||| ||| |||||||||| |
|
|
| T |
16450310 |
gggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgc |
16450407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 29895791 - 29895852
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29895791 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
29895852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 13073542 - 13073645
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||||| |||||||| | | | ||||||| ||||||||||||||||| |||||||||||||| | |||||||| || |||||| || | ||| |||||| |
|
|
| T |
13073542 |
aataccgagttcgattcccatggggaacaatgtttggccagtgcgcatacctctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccg |
13073641 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
13073642 |
gtgc |
13073645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 33647725 - 33647828
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||| ||||||| ||| |||||||||| ||| | |||||||| |||| |||| || ||||| |||||| |
|
|
| T |
33647725 |
aataccgggttcgatttccagggagaacaacgcttgaccagtgcacattcctctacgcacgaaccagattagtcgttcatctttggtggatcggaaaccg |
33647824 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
33647825 |
gtgc |
33647828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 161
Target Start/End: Complemental strand, 40272438 - 40272379
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
|||| ||||||||||||| | | ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40272438 |
aatatcgggttcgatttccatggggaacaacgcttggccagtgcgcatgcctctacgcat |
40272379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 109 - 163
Target Start/End: Original strand, 4738629 - 4738683
Alignment:
| Q |
109 |
ggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| ||||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
4738629 |
ggttcgatttccaggaggaacaacgctttgccagtgcgcatgtctctacgcatga |
4738683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 203
Target Start/End: Original strand, 8889026 - 8889128
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||| ||||||||||| |||||||||||| | |||||||| | ||||||| || | ||| |||||| |
|
|
| T |
8889026 |
aataccgggttcgattcctagggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccg |
8889125 |
T |
 |
| Q |
201 |
gtg |
203 |
Q |
| |
|
||| |
|
|
| T |
8889126 |
gtg |
8889128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 109 - 163
Target Start/End: Original strand, 20421784 - 20421838
Alignment:
| Q |
109 |
ggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20421784 |
ggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
20421838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 47078462 - 47078520
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
47078462 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgca |
47078520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 123 - 160
Target Start/End: Complemental strand, 295619 - 295582
Alignment:
| Q |
123 |
gaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
295619 |
gaggaacaacgtttggccagtgcgcatgcctctacgca |
295582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 16645122 - 16645183
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||| |||| |||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
16645122 |
aataccgggttcgattttcaggaagaacaacgcttggccagtgtgcatgcctctacacatga |
16645183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 98 - 163
Target Start/End: Original strand, 20354637 - 20354702
Alignment:
| Q |
98 |
gaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| ||| |||||| ||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
20354637 |
gaaaaataccgagtttgatttccagggagaacaacgcttggctagtgcgcatgcctctacgcatga |
20354702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 38075437 - 38075498
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| ||| | ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38075437 |
aataccgggttcgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatga |
38075498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 133 - 204
Target Start/End: Complemental strand, 14597976 - 14597904
Alignment:
| Q |
133 |
gtttggccagtgcgcatgcctctacgcatgaa-tcgattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| | |||||||| | ||||||| | |||||||||||||||| |
|
|
| T |
14597976 |
gtttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgc |
14597904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 17080070 - 17080150
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| | |||||||| ||||||| | |||||||||||||||| |
|
|
| T |
17080070 |
ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgc |
17080150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 21192645 - 21192702
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21192645 |
aaataccgggttcgagttcc--gaggaacaacgttgggccagtgcgcatgcctctacgca |
21192702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 14124020 - 14124075
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||| ||||||||| | ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
14124020 |
aataccaggttcgattcccagggggaacaacatttggccagtgcgcatgcctctac |
14124075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 24166454 - 24166557
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||| |||||||||| | | | | |||||||||||||||||||||||||||||||||| || | ||||||||| ||||||| | ||||| |||||| |
|
|
| T |
24166454 |
aatactgggttcgattcccaagggaaacaacgtttggccagtgcgcatgcctctacgcacgagccagattagtcacccacctttgatggatcggaaaccg |
24166553 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
24166554 |
gtgc |
24166557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 184
Target Start/End: Original strand, 52950086 - 52950169
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||| ||||||||||| | ||| ||||||||| |||||||||||||||| |||||| |||||| | |||||||| | ||||||| |
|
|
| T |
52950086 |
aatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccaccttt |
52950169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 10541020 - 10541078
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||||||||||||| ||| | ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
10541020 |
aatatcgggttcgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgca |
10541078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 100 - 204
Target Start/End: Complemental strand, 40780970 - 40780865
Alignment:
| Q |
100 |
aaaataccgggttcgatt-tctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaa |
197 |
Q |
| |
|
|||||| ||||||||||| || ||| ||||||||| |||| |||||||||||||||||||||||| | |||||||| | ||||||| || | ||| ||| |
|
|
| T |
40780970 |
aaaatatcgggttcgattctcaagg-ggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaa |
40780872 |
T |
 |
| Q |
198 |
ccggtgc |
204 |
Q |
| |
|
||||||| |
|
|
| T |
40780871 |
ccggtgc |
40780865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 48015180 - 48015122
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | || ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
48015180 |
aataccgggttcgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgca |
48015122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 6779215 - 6779276
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
6779215 |
aataccgggttcgattcccagggggaacaacacctggccagtgcgcatgcctctatgcatga |
6779276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 43468351 - 43468412
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
43468351 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcacatttctctacgcatga |
43468412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 55921038 - 55921099
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
55921038 |
aataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatga |
55921099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 158
Target Start/End: Original strand, 43458617 - 43458673
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacg |
158 |
Q |
| |
|
||||| || ||||||| | |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
43458617 |
aatactggattcgattcccaggaggaagaacgcttggccagtgcgcatgcctctacg |
43458673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 8064905 - 8064802
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||| |||||||||| | | | |||| ||| ||| ||||||||||||||||||||||||| | |||||||| | |||| ||| ||| |||||||||| |
|
|
| T |
8064905 |
aatactgggttcgattcccaaggggaataacacttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattaataggtcgaaaaccg |
8064806 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
8064805 |
gtgc |
8064802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 27248432 - 27248488
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||| | | ||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
27248432 |
aataccgggttcgagtcccaggaggaacaacgcttggcca--gcgcatgcctctacgca |
27248488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 29588739 - 29588798
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||||||| | ||| | ||||| | ||||| |||||||||||||||||||| |
|
|
| T |
29588739 |
aaataccgggttcgattcccaggggaaacaaagcttggctagtgcgcatgcctctacgca |
29588798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 36262872 - 36262816
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
36262872 |
aataccgggttcgattcccagg--gaacaacgcttggccagtgcacatgcctctacgca |
36262816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 160
Target Start/End: Complemental strand, 49260749 - 49260714
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49260749 |
ggaacaacgcttggccagtgcgcatgcctctacgca |
49260714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 126 - 156
Target Start/End: Original strand, 8424582 - 8424612
Alignment:
| Q |
126 |
gaacaacgtttggccagtgcgcatgcctcta |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8424582 |
gaacaacgtttggccagtgcgcatgcctcta |
8424612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 111 - 184
Target Start/End: Original strand, 14859304 - 14859378
Alignment:
| Q |
111 |
ttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||||||| ||||||||| || | |||||||||| ||||||| |
|
|
| T |
14859304 |
ttcgattttcaggaggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtcatccaccttt |
14859378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 15732555 - 15732497
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| || | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
15732555 |
aataccgggttcgattcatatggggaacaacacttggccagtgcacatgcctctacgca |
15732497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 38166031 - 38166089
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||| ||||| |||| | ||| ||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
38166031 |
aatactgggttggattcccagggggaacaacgcttggccagtgcgcatggctctacgca |
38166089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 163
Target Start/End: Original strand, 46108718 - 46108756
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
46108718 |
ggaacaacatttggctagtgcgcatgcctctacgcatga |
46108756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 98 - 160
Target Start/End: Complemental strand, 48317386 - 48317324
Alignment:
| Q |
98 |
gaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||| |||| ||||| | ||||||||||||| |
|
|
| T |
48317386 |
gaaaaatactggattcgattttcaggaggaacaacgcttggtcagtgtgtatgcctctacgca |
48317324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 160
Target Start/End: Complemental strand, 5472930 - 5472897
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
5472930 |
aacaacgcttggccagtgcgcatgcctctacgca |
5472897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 36145322 - 36145261
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| | ||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
36145322 |
aataccgggttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatga |
36145261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 161
Target Start/End: Original strand, 35359763 - 35359799
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
35359763 |
ggaacaacgtttgaccagtgcgcatgcctcaacgcat |
35359799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 163
Target Start/End: Complemental strand, 49952228 - 49952192
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
49952228 |
aacaacgtttggtcagtgcgcacgcctctacgcatga |
49952192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 8e-28; HSPs: 54)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 7747273 - 7747376
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| | |||||||| |||||||||||| | ||| |||||| |
|
|
| T |
7747273 |
aataccgggttcgattcctaggaggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccg |
7747372 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
7747373 |
gtgc |
7747376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 41220634 - 41220737
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcg-attagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||| || ||||||| |||||||||||| | ||| |||||| |
|
|
| T |
41220634 |
aataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacctttagtgggtcggaaaccg |
41220733 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
41220734 |
gtgc |
41220737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 102 - 184
Target Start/End: Original strand, 38962762 - 38962845
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| | |||||||| | ||||||| |
|
|
| T |
38962762 |
aataccgggttcgattttcaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccaccttt |
38962845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 3643994 - 3643933
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3643994 |
aataccgggtttgatttctacgaggaacaacgcttggccagtgcgcatgcctctacgcatga |
3643933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 100 - 163
Target Start/End: Complemental strand, 10026725 - 10026662
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10026725 |
aaaataccgggttcgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatga |
10026662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 25540511 - 25540408
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||| |||||||||| ||||| ||||||||| |||||||||||||||||||||||||| || | |||||||| | ||||||| || | ||| |||||| |
|
|
| T |
25540511 |
aatactgggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaaccg |
25540412 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
25540411 |
gtgc |
25540408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 184
Target Start/End: Complemental strand, 39806992 - 39806909
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||||||||||||||| | | ||| ||||||||||||||||||||||||||||||| || || || |||||||||| ||||||| |
|
|
| T |
39806992 |
aataccgggttcgattcccaagagaaacaacgtttggccagtgcgcatgcctctacacacgagtcggattagtcatccaccttt |
39806909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 10823059 - 10823117
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||| |||| | ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10823059 |
aataccgggtttgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgca |
10823117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 203
Target Start/End: Complemental strand, 6358258 - 6358156
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||| | ||||||||| ||| |||||||| ||||||||||||||||||||||||||||| | |||||||| | |||| || || | |||||||||| |
|
|
| T |
6358258 |
aataccagattcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcgaaaaccg |
6358159 |
T |
 |
| Q |
201 |
gtg |
203 |
Q |
| |
|
||| |
|
|
| T |
6358158 |
gtg |
6358156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 9360855 - 9360797
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| ||||||||| |||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
9360855 |
aataccaggttcgattactagaggaaacaacgtttggccagtgcgcatgcctctacgca |
9360797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 11069877 - 11069935
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| ||||||||| | ||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11069877 |
aataccaggttcgattccgagggggaacaacgtttggccagtgcgcatacctctacgca |
11069935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 12455309 - 12455367
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||| || ||||||||||||||||||||||| |
|
|
| T |
12455309 |
aataccgggttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgca |
12455367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 44139483 - 44139541
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
44139483 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgca |
44139541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 45263774 - 45263716
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | || ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45263774 |
aataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcctctacgca |
45263716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 331500 - 331561
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
331500 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatga |
331561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 13026518 - 13026457
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| ||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
13026518 |
aatatcgggttcgattatcaggaggaacaatgattggccagtgcgcatgcctctacgcatga |
13026457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 34356205 - 34356266
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
34356205 |
aataccgggttcgatttccagggggaacaacacttggtcagtgcgcatgcctctatgcatga |
34356266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 93 - 184
Target Start/End: Complemental strand, 3849030 - 3848938
Alignment:
| Q |
93 |
tatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||||| | |||||||||||||||| ||| | |||||||||||||||| ||||||| ||||||||| || || |||||||| ||||||||| |
|
|
| T |
3849030 |
tatctggagaataccgggttcgattatcaggggaaacaacgtttggccagggcgcatgtctctacgcacgagtcggattagtcgttcaccttt |
3848938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 7787055 - 7787158
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| ||||||||| |||||||||||||||| || | |||||||| || |||| || |||||||||||| |
|
|
| T |
7787055 |
aataccgggttcgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgcccatctttggtggatcgaaaaccg |
7787154 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
7787155 |
gtgc |
7787158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 161
Target Start/End: Complemental strand, 19976914 - 19976855
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
||||||||||||||||| ||| |||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
19976914 |
aataccgggttcgattttcagggggaataacgtttggtcagtgcgcatgtctctacgcat |
19976855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 100 - 163
Target Start/End: Original strand, 25604592 - 25604654
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
25604592 |
aaaataccggattcgatttccagg-ggaacaacgtttgaccagtatgcatgcctctacgcatga |
25604654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 125 - 203
Target Start/End: Complemental strand, 39201592 - 39201513
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtg |
203 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| | |||||||| ||||||||| || | ||| ||||||||| |
|
|
| T |
39201592 |
ggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtcggaaaccggtg |
39201513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 161
Target Start/End: Complemental strand, 40969022 - 40968963
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
40969022 |
aataccgggttcgatttccagggaaaacaacgtttggtcagtgcgaatgcctctacgcat |
40968963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 8410130 - 8410188
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
8410130 |
aatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgca |
8410188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 21286443 - 21286501
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| | ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
21286443 |
aataccgggttcgattcccaggcgaaacaacgcttgaccagtgcgcatgcctctacgca |
21286501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 163
Target Start/End: Original strand, 24179590 - 24179628
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24179590 |
ggaacaacgtttggccagtgcacatgcctctacgcatga |
24179628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 2550867 - 2550928
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| | |||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
2550867 |
aatatcgggttcgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatga |
2550928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 104 - 204
Target Start/End: Original strand, 10669593 - 10669694
Alignment:
| Q |
104 |
taccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggt |
202 |
Q |
| |
|
||||||||| |||| | ||| |||||||| |||||||||||||||| ||||||||| || || ||||| || ||||||||| || | ||| |||||||| |
|
|
| T |
10669593 |
taccgggtttgattcccagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtcggaaaccggt |
10669692 |
T |
 |
| Q |
203 |
gc |
204 |
Q |
| |
|
|| |
|
|
| T |
10669693 |
gc |
10669694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 12864223 - 12864284
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
12864223 |
aataccggattcgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatga |
12864284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 126 - 163
Target Start/End: Complemental strand, 13104908 - 13104871
Alignment:
| Q |
126 |
gaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13104908 |
gaacaacgcttggccagtgcgcatgcctctacgcatga |
13104871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 18649133 - 18649072
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||| ||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
18649133 |
aataccggattcgattctcaggaggaacaatatttgggcagtgcgcatgcctctacgcatga |
18649072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 110 - 163
Target Start/End: Original strand, 22593142 - 22593194
Alignment:
| Q |
110 |
gttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| | ||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22593142 |
gttcgattcccagggggaacaacgtt-ggccagtgcgcatgcctctacgcatga |
22593194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 38005401 - 38005462
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| |||||||||| | | | ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
38005401 |
aatactgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatga |
38005462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 119 - 163
Target Start/End: Complemental strand, 20116702 - 20116658
Alignment:
| Q |
119 |
ctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
20116702 |
ctaggaggaacaacgcatggccaatgcgcatgcctctacgcatga |
20116658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 200
Target Start/End: Original strand, 26805314 - 26805394
Alignment:
| Q |
121 |
aggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||||||||||||| || |||||||| ||||||| || | |||||||||| |
|
|
| T |
26805314 |
aggagaaacgacgtttggccagtgcacatgcctctacgcatgagtcggattagtcgcccacctttggtggctcgaaaaccg |
26805394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 160
Target Start/End: Complemental strand, 2149278 - 2149243
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2149278 |
ggaataacgtttggccagtgcgcatgcctctacgca |
2149243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 160
Target Start/End: Original strand, 27725958 - 27725997
Alignment:
| Q |
121 |
aggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
27725958 |
aggaggaacaatgcttggccagtgcgcatgcctctacgca |
27725997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 29653625 - 29653684
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
29653625 |
aaataccggattcgatttccagggaaaacaacgcttgggcagtgcgcatgcctctacgca |
29653684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 160
Target Start/End: Original strand, 37560195 - 37560230
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37560195 |
ggaacaacgtttggtcagtgcgcatgcctctacgca |
37560230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 41032010 - 41031955
Alignment:
| Q |
105 |
accgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||| | ||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
41032010 |
accgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgca |
41031955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 42770759 - 42770700
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||| ||| ||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
42770759 |
aaataccgggttcaattctcagggggaacaacgcttggccagtgcgcatgcctcttcgca |
42770700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 15079482 - 15079540
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||| ||| |||||| ||||| ||||||||| |
|
|
| T |
15079482 |
aatacagggttcgatttccagggggaacaacgcttgaccagtgtgcatgactctacgca |
15079540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 20612643 - 20612581
Alignment:
| Q |
102 |
aataccgggttcgatttctaggagg-aacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| |||||| |||||| |||||||||||||||||||||| |||||| |
|
|
| T |
20612643 |
aataccgggttcgattctcaggagggaacaacacttggccagtgcgcatgcctctatgcatga |
20612581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 163
Target Start/End: Original strand, 33005773 - 33005811
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33005773 |
ggaacaacacttggccagtgcgcatgcctctacgcatga |
33005811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 35946738 - 35946795
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
35946738 |
aataccgagttcgattcctagg-ggaacaacgcttggccattgtgcatgcctctacgca |
35946795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 93 - 163
Target Start/End: Original strand, 41187699 - 41187769
Alignment:
| Q |
93 |
tatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
41187699 |
tatctgaagaataccgggttcgattatgagggggaacaacacttgaccagtgtccatgcctctacgcatga |
41187769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 204
Target Start/End: Original strand, 44945613 - 44945695
Alignment:
| Q |
123 |
gaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| || | |||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
44945613 |
gaggaacaacgcttggatagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgc |
44945695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 163
Target Start/End: Original strand, 16325602 - 16325655
Alignment:
| Q |
110 |
gttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| | ||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
16325602 |
gttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatga |
16325655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 105 - 157
Target Start/End: Complemental strand, 2528445 - 2528393
Alignment:
| Q |
105 |
accgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
||||||||||||| | ||| ||||||||| |||| ||||| |||||||||||| |
|
|
| T |
2528445 |
accgggttcgattcccagggggaacaacgcttggtcagtgtgcatgcctctac |
2528393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 102 - 158
Target Start/End: Original strand, 16034936 - 16034992
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacg |
158 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||| |||||| |||||||| |||| |
|
|
| T |
16034936 |
aataccgggttcgattttcaggcggaacaacgcttgaccagtgtgcatgcctatacg |
16034992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 185
Target Start/End: Complemental strand, 28525554 - 28525478
Alignment:
| Q |
111 |
ttcgatttctaggaggaa-caacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttta |
185 |
Q |
| |
|
||||||||| ||| |||| |||| |||||||||||||||||||||||||| || | |||||||||| |||||||| |
|
|
| T |
28525554 |
ttcgatttccagggggaaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcatccaccttta |
28525478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 104 - 168
Target Start/End: Original strand, 29421285 - 29421347
Alignment:
| Q |
104 |
taccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcga |
168 |
Q |
| |
|
||||||||| |||||| ||| ||||||||| |||| ||||| |||||||||||||||||| |||| |
|
|
| T |
29421285 |
taccgggtttgatttc-agg-ggaacaacgcttgggcagtgagcatgcctctacgcatgagtcga |
29421347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 34346371 - 34346291
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||| || ||||| || |||||||| || | ||| |||||||||| |
|
|
| T |
34346371 |
ggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgc |
34346291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 127 - 163
Target Start/End: Original strand, 41187873 - 41187909
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
41187873 |
aacaacgcttgaccagtgcgcatgcctctacgcatga |
41187909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 2e-25; HSPs: 36)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 102 - 200
Target Start/End: Original strand, 10927609 - 10927708
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||||||| | ||| |||||| |
|
|
| T |
10927609 |
aataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccg |
10927708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 102 - 200
Target Start/End: Original strand, 6100475 - 6100574
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||||||| |||||||||| | |||||||| |||||||||||| | |||||||||| |
|
|
| T |
6100475 |
aataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccg |
6100574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 102 - 200
Target Start/End: Complemental strand, 1013084 - 1012985
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcg-attagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||| | ||||||||||||||||| || |||| || |||||||||||| |||||||||||| |
|
|
| T |
1013084 |
aataccgggttcgattcccagggggaacaacgcttggccagtacacatgcctctacgcatgagccgaattaatcgttcacctttagtggatcgaaaaccg |
1012985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 3418620 - 3418517
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||| || |||||||| | |||||||||| | || |||||| |
|
|
| T |
3418620 |
aatatcgggttcgatttttaggaggaacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccg |
3418521 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
3418520 |
gtgc |
3418517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 8141105 - 8141166
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8141105 |
aataccgggttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatga |
8141166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 583816 - 583876
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
583816 |
aaataccgggttcgattcctagg--gaacaacgcttgaccagtgcgcatgcctctacgcatga |
583876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 4479402 - 4479300
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga-atcgattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||| ||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| | |||||||| | ||||||| || | ||| |||||| |
|
|
| T |
4479402 |
aataccggattcgattcccagg-ggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccg |
4479304 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
4479303 |
gtgc |
4479300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 44893385 - 44893327
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
44893385 |
aataccgggttcaatttctagggggaacaatgcttggccagtgtgcatgcctctacgca |
44893327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 2467225 - 2467164
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
2467225 |
aataccgggttcgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatga |
2467164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 202
Target Start/End: Complemental strand, 24938669 - 24938568
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||| |||||||||||||| | |||||| |||| || |||||||||||||||||||||| | |||||||||| ||||||| | ||||| |||||| |
|
|
| T |
24938669 |
aataccaggttcgatttctagatgaaacaacacttggtcaatgcgcatgcctctacgcatgaaccggattagtcatccacctttgatggatcggaaaccg |
24938570 |
T |
 |
| Q |
201 |
gt |
202 |
Q |
| |
|
|| |
|
|
| T |
24938569 |
gt |
24938568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 43027308 - 43027369
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| |||||||||| | ||||||||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
43027308 |
aatactgggttcgattcccaggaggaacaacgattgtccaatgcgcatgcctctacgcatga |
43027369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 8997651 - 8997548
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||||| |||||||| ||| | |||||||||||| |||||| ||||||||| ||||||||| | |||||||| |||| |||| || | ||| |||||| |
|
|
| T |
8997651 |
aataccgtgttcgattcctaaggggaacaacgtttcgccagttcgcatgcctatacgcatgagccagattagtcgttcatctttggtgggtcggaaaccg |
8997552 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
8997551 |
gtgc |
8997548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 33401906 - 33401815
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatc |
192 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||| |||||| |||||||||||||||||| || |||||||| |||||||||| |||| |
|
|
| T |
33401906 |
aataccgggttcgattttcagggggaacaacacttgaccagtgtgcatgcctctacgcatgagtcggattagtcgcccacctttagtggatc |
33401815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 14666178 - 14666120
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
14666178 |
aataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgca |
14666120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 34613885 - 34613831
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctcta |
156 |
Q |
| |
|
|||| ||||||||||| | |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
34613885 |
aatatcgggttcgattcccaggaggaacaacgtctggccagtacgcatgcctcta |
34613831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 38922521 - 38922463
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | || ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
38922521 |
aataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcctttacgca |
38922463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 130 - 202
Target Start/End: Original strand, 3692864 - 3692937
Alignment:
| Q |
130 |
aacgtttggccagtgcgcatgcctctacgcatgaatcg-attagtcattcacctttagtagatcgaaaaccggt |
202 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| || |||| || ||||||||| |||| |||||||||||| |
|
|
| T |
3692864 |
aacgtttggtcagtgcgcatacctctacgcatgagccgaattaatcgttcacctttggtaggtcgaaaaccggt |
3692937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 6042824 - 6042885
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | | | ||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
6042824 |
aataccgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctaaacgcatga |
6042885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 9860102 - 9860041
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
9860102 |
aataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacacatga |
9860041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 33935842 - 33935781
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
33935842 |
aataccggattcgattcctagggagaacaacacttggccagtgcgcatgcctatacgcatga |
33935781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 149
Target Start/End: Original strand, 6940544 - 6940608
Alignment:
| Q |
85 |
caaggagctatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcat |
149 |
Q |
| |
|
||||||| |||| | |||||| ||||||||||||| ||| ||||||||| ||||| ||||||||| |
|
|
| T |
6940544 |
caaggaggtatccggaaaatatcgggttcgatttccaggtggaacaacgcttggctagtgcgcat |
6940608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 13359023 - 13359083
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||| || |||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
13359023 |
aaaataccgggttcgattctcagaaggaacaacgcttggacagtgcgcatacctctacgca |
13359083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 204
Target Start/End: Original strand, 18374012 - 18374116
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaacc |
199 |
Q |
| |
|
||||||| ||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| | |||||||| | || |||| || | ||||||||| |
|
|
| T |
18374012 |
aaataccaggttcgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaactttggtgggtcgaaaacc |
18374111 |
T |
 |
| Q |
200 |
ggtgc |
204 |
Q |
| |
|
||||| |
|
|
| T |
18374112 |
ggtgc |
18374116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 157
Target Start/End: Original strand, 43032903 - 43032959
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
||||| ||| ||||||| | ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
43032903 |
aaatatcggattcgattcccagggggaacaacgcttggccagtgcgcatgcctctac |
43032959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 17981443 - 17981502
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||||||| | ||| |||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
17981443 |
aaataccgggttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgca |
17981502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 2964079 - 2964137
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||| | | ||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
2964079 |
aataccgtgttcgattccgatgaggaacaacgcttggccaatgtgcatgcctctacgca |
2964137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 163
Target Start/End: Complemental strand, 8587023 - 8586985
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8587023 |
ggaacaacgcttggccagtgcgcatacctctacgcatga |
8586985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 15884662 - 15884605
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
15884662 |
aataccgggttcgattcccagg-ggaacaacacttggcaagtgcgcatgcctctacgca |
15884605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 160
Target Start/End: Original strand, 20240581 - 20240631
Alignment:
| Q |
110 |
gttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||| |||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
20240581 |
gttcgatttccaggaaaaataacgtttggtcagtgcgcatgcctctacgca |
20240631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 160
Target Start/End: Complemental strand, 20252486 - 20252436
Alignment:
| Q |
110 |
gttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||| |||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
20252486 |
gttcgatttccaggaaaaataacgtttggtcagtgcgcatgcctctacgca |
20252436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 26570926 - 26570988
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| ||||||| ||| ||||| ||||||||| |||||||||| | |||| ||||||||||| |
|
|
| T |
26570926 |
aaatatcgggttcaattcctagggggaacaacgcttggccagtgtgtatgcatctacgcatga |
26570988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 11785919 - 11785979
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||| | ||| ||| |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
11785919 |
aataccggattcgattccaagg-ggagcaacgtttgggcagtgtgcatgcctctacgcatga |
11785979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 14846579 - 14846639
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| ||| ||||||| | |||| |||||||||||||||||||||||| |
|
|
| T |
14846579 |
aataccgggttcgattctcagg-ggaacaatgattggtcagtgcgcatgcctctacgcatga |
14846639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 127 - 160
Target Start/End: Original strand, 18091428 - 18091461
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
18091428 |
aacaacgtttgaccagtgcgcatgcctctacgca |
18091461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 45521172 - 45521232
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
45521172 |
aataccgggttcgattcccagg-ggaacaacacttgatcagtgcgcatgcctctacgcatga |
45521232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 7673746 - 7673706
Alignment:
| Q |
120 |
taggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
7673746 |
tagggggaacaacgtttggctagtgtgcatgcctctacgca |
7673706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 2e-25; HSPs: 27)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 21898651 - 21898754
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||||||| | ||| |||||| |
|
|
| T |
21898651 |
aataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccg |
21898750 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
21898751 |
gtgc |
21898754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 103 - 163
Target Start/End: Complemental strand, 29444871 - 29444811
Alignment:
| Q |
103 |
ataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29444871 |
ataccgggttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatga |
29444811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 29333245 - 29333185
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29333245 |
aataccgggttcgatttccagg-ggaacaacgtttggccagtgcgcatgcctctacgcatga |
29333185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 101 - 161
Target Start/End: Complemental strand, 33859427 - 33859367
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33859427 |
aaataccgggttcgatttttagggggaacaacgtttgcccagtgcgcatgcctctacgcat |
33859367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 12606433 - 12606491
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| | ||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12606433 |
aataccagattcgatttccagggggaacaacgtttggccagtgcgcatgcctctacgca |
12606491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 5253330 - 5253269
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5253330 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
5253269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 14107465 - 14107404
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
14107465 |
aataccgggttcgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcatga |
14107404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 13584557 - 13584497
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatg |
162 |
Q |
| |
|
|||||| ||||||||| ||| || ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13584557 |
aataccaggttcgattcctaagatgaacaacgtttggccagtgcgcatgcctctatgcatg |
13584497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 8612081 - 8612019
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaa |
164 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||| |||||| |||||| |||||||||||| |
|
|
| T |
8612081 |
aataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaa |
8612019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 127 - 199
Target Start/End: Original strand, 8888910 - 8888983
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaacc |
199 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || |||||||| | ||||||| | ||||||||||| |
|
|
| T |
8888910 |
aacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcgtccacctttgatggatcgaaaacc |
8888983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 13036111 - 13036050
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| |||||||||||| ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13036111 |
aatatcgggttcgattttcagggggaacaacacttggccagtgcgcatgcctctacgcatga |
13036050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 109 - 160
Target Start/End: Complemental strand, 9366523 - 9366472
Alignment:
| Q |
109 |
ggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||| |||| |||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9366523 |
ggttcgatttttagggggaataacgcttggccagtgcgcatgcctctacgca |
9366472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 3588052 - 3587990
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaa |
164 |
Q |
| |
|
|||||||||||||||| | | | ||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
3588052 |
aataccgggttcgattcccaaggggaacaacgcttggccagtgcacatacctctacgcatgaa |
3587990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 114 - 163
Target Start/End: Complemental strand, 375069 - 375020
Alignment:
| Q |
114 |
gatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| || |||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
375069 |
gatttttaagaggaataacgtttggccagtgcgcatgcctctatgcatga |
375020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 126 - 163
Target Start/End: Original strand, 5029844 - 5029881
Alignment:
| Q |
126 |
gaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5029844 |
gaacaacgtttggtcagtgcgcatgcctctacgcatga |
5029881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 8932664 - 8932725
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
8932664 |
aatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatga |
8932725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 8944130 - 8944191
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
8944130 |
aatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatga |
8944191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 34954726 - 34954665
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
34954726 |
aataccaggttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatga |
34954665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 163
Target Start/End: Original strand, 11142631 - 11142667
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11142631 |
aacaacgtttgaccagtgcgcatgcctctacgcatga |
11142667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 160
Target Start/End: Original strand, 13391312 - 13391347
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13391312 |
ggaacaatgtttggccagtgcgcatgcctctacgca |
13391347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 156
Target Start/End: Complemental strand, 30788937 - 30788906
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctcta |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30788937 |
ggaacaacgtttggccagtgcgcatgcctcta |
30788906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 101 - 143
Target Start/End: Complemental strand, 2105198 - 2105156
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagt |
143 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
2105198 |
aaataccgggttcgatttctaggggaaacaacgcttggccagt |
2105156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 126 - 160
Target Start/End: Complemental strand, 9633708 - 9633674
Alignment:
| Q |
126 |
gaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
9633708 |
gaacaacgcttggccagtgcgcatgcctctacgca |
9633674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 13468936 - 13468994
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| ||||| ||| ||||| ||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
13468936 |
aataccaggttcaattcctagggggaacaacgattggtcagtgcacatgcctctacgca |
13468994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 6606204 - 6606143
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| ||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
6606204 |
aataccgggttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatga |
6606143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 10396486 - 10396550
Alignment:
| Q |
111 |
ttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtca |
175 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||| ||||| |||||| || ||||||||| |
|
|
| T |
10396486 |
ttcgatttttagg-ggaacaacgtttggccagtgcgcatatctctatgcatgagtcggattagtca |
10396550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 111 - 163
Target Start/End: Complemental strand, 17114995 - 17114943
Alignment:
| Q |
111 |
ttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||| |||| |||||||||| ||||||| || ||||||||||||||||| |
|
|
| T |
17114995 |
ttcgattcctagaaggaacaacgcttggccaatggacatgcctctacgcatga |
17114943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 5e-23; HSPs: 47)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 5732027 - 5731924
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||||||||||||||||| |||| | |||||||| |||||||||||| | ||| |||||| |
|
|
| T |
5732027 |
aataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccg |
5731928 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
5731927 |
gtgc |
5731924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 111 - 204
Target Start/End: Original strand, 40117424 - 40117518
Alignment:
| Q |
111 |
ttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||| ||| ||||||||| ||||||||||||||||||||||||||||| | ||||| || ||||||||| || |||||||||||||||| |
|
|
| T |
40117424 |
ttcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgc |
40117518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 101 - 163
Target Start/End: Complemental strand, 11845909 - 11845847
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11845909 |
aaatatcgggttcgatttcgagggggaacaacgtttggccagtgcgcatgcctctacgtatga |
11845847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 9805004 - 9805065
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9805004 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatga |
9805065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 64 - 160
Target Start/End: Original strand, 21149696 - 21149792
Alignment:
| Q |
64 |
aagttgtttggactctagtgacaaggagctatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||||| |||| |||||| ||| ||| |||||| |||||||||| ||| ||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
21149696 |
aagttgtttggactccagtggcaaggacgtatttgaggaataccaggttcgattttcagggggaacaacgtttgaccagtgcgcatgactctacgca |
21149792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 42086327 - 42086430
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||| ||||||||||||||||||||||||| | |||||||| | ||||||| || | ||| |||||| |
|
|
| T |
42086327 |
aataccgggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccg |
42086426 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
42086427 |
gtgc |
42086430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 7866581 - 7866639
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7866581 |
aataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgca |
7866639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 9812872 - 9812934
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaa |
164 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
9812872 |
aataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcttctacgcatgaa |
9812934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 38897825 - 38897768
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38897825 |
aataccgggttcgatttccagg-ggaacaacgcttggccagtgcgcatgcctctacgca |
38897768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 1538431 - 1538492
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1538431 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
1538492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 23383657 - 23383718
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
23383657 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatga |
23383718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 28857128 - 28857189
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28857128 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
28857189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 30349579 - 30349640
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| |||||||||| ||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
30349579 |
aataccgggtttgatttctagggggaacaatgattggccagtgcgcatgcctctatgcatga |
30349640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 3654019 - 3653918
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||| |||||||||||||||||||||| || | |||||||| | ||||||| || |||||||||||| |
|
|
| T |
3654019 |
aataccgggttcgattcctaga--gaacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccg |
3653922 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
3653921 |
gtgc |
3653918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 25417290 - 25417234
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacg |
158 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
25417290 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacg |
25417234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 101 - 156
Target Start/End: Original strand, 31890089 - 31890144
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctcta |
156 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
31890089 |
aaataccgaattcgatttctaggaggaacaacgtttgaccagtgcacatgcctcta |
31890144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 123 - 204
Target Start/End: Complemental strand, 9168339 - 9168257
Alignment:
| Q |
123 |
gaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||| | |||||||| | |||||||||| | ||||||| |||||| |
|
|
| T |
9168339 |
gaggaacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaatcggtgc |
9168257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 12705014 - 12705076
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaa |
164 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||| |||||| |||||| |||||||||||| |
|
|
| T |
12705014 |
aataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaa |
12705076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 12766131 - 12766193
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaa |
164 |
Q |
| |
|
|||||||||||||||| ||||||||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
12766131 |
aataccgggttcgattctgaggaggaacaatgcttggccagtgtgcatgcctctacgcatgaa |
12766193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 14588724 - 14588663
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| |||||||||||| |||||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
14588724 |
aatatcgggttcgattttcaggaggaataacgcttgaccagtgcgcatgcctctacgcatga |
14588663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 19572724 - 19572785
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| |||| | ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19572724 |
aataccgggttagattcccagggggaacaacacttggccagtgcgcatgcctctacgcatga |
19572785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 41163566 - 41163506
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
41163566 |
aataccgggttcgattcccagg-ggaacaacgtttggccagtgcacatgtctctacgcatga |
41163506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 20682718 - 20682666
Alignment:
| Q |
108 |
gggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||| |||||| ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20682718 |
gggttagatttccagggggaacaacgcttggccagtgcgcatgcctctacgca |
20682666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 8513519 - 8513622
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| ||||| | ||||| | ||||||||||| |||||||||||||| || | |||||||| | ||||||| || | ||| |||||| |
|
|
| T |
8513519 |
aataccgggttcgattcctaggggaaacaatgcttggccagtgcacatgcctctacgcacgagccagattagtcgtccacctttggtgggtcggaaaccg |
8513618 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
8513619 |
gtgc |
8513622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 20525838 - 20525941
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||| || |||||||||||||||||||||||||| | |||||||| | |||| || || ||||| |||||| |
|
|
| T |
20525838 |
aatatcgggttcgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcggaaaccg |
20525937 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
20525938 |
gtgc |
20525941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 151
Target Start/End: Original strand, 1899001 - 1899050
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgc |
151 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||||||||||| |
|
|
| T |
1899001 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgc |
1899050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 7308471 - 7308410
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| | ||| ||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
7308471 |
aatatcgggttcgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatga |
7308410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 13664260 - 13664321
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||| ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13664260 |
aataccggattcgattatcagggggaacaacacttggccagtgcgcatgcctctacgcatga |
13664321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 110 - 155
Target Start/End: Original strand, 21487625 - 21487670
Alignment:
| Q |
110 |
gttcgatttctaggaggaacaacgtttggccagtgcgcatgcctct |
155 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21487625 |
gttcgattttcaggaggaacaacgtttggctagtgcgcatgcctct |
21487670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 25467419 - 25467468
Alignment:
| Q |
111 |
ttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
25467419 |
ttcgattttcaggaggaacaacgattggccagtacgcatgcctctacgca |
25467468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 37263263 - 37263343
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||| || | |||||||| | |||||||| | ||||| |||||||||| |
|
|
| T |
37263263 |
ggaacaacgcttggccaatgcgcatgcctctacgcacgagccggattagtcgtccacctttattggatcggaaaccggtgc |
37263343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 126 - 161
Target Start/End: Original strand, 20705587 - 20705622
Alignment:
| Q |
126 |
gaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20705587 |
gaacaacgtttggtcagtgcgcatgcctctacgcat |
20705622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 35403620 - 35403561
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
35403620 |
aaataccgggttcgattctaagggggaacaacgcttggccaatgcgcatgtctctacgca |
35403561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 42291612 - 42291509
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||||||||| |||| | ||| |||||||| ||||||||||| |||||||||||||| || | |||||||| | ||||||| | ||||| |||||| |
|
|
| T |
42291612 |
aataccgggtttgattcccagggtgaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgatggatcggaaaccg |
42291513 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
42291512 |
gtgc |
42291509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 12081908 - 12081966
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||| |||||||||| ||| ||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
12081908 |
aatactgggttcgattctcagggggaacaacgcttggccagtgcgcatgcatctacgca |
12081966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 163
Target Start/End: Complemental strand, 14974408 - 14974370
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
14974408 |
ggaacaacatttggccagtgcacatgcctctacgcatga |
14974370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 125 - 163
Target Start/End: Original strand, 20590022 - 20590060
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
20590022 |
ggaacaacgcttggccagtgcgcatgactctacgcatga |
20590060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 30995121 - 30995179
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| ||||||||| | ||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
30995121 |
aataccaggttcgattcccagggggaacaacacttggccagggcgcatgcctctacgca |
30995179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 96 - 157
Target Start/End: Complemental strand, 4016368 - 4016307
Alignment:
| Q |
96 |
ctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||| ||||| ||||||||||| ||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
4016368 |
ctgagaaatatcgggttcgattatcagggggaacaacacttggccagtgcgcatgcctctac |
4016307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 161
Target Start/End: Original strand, 16757384 - 16757437
Alignment:
| Q |
108 |
gggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
|||||||||||| | |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
16757384 |
gggttcgatttccggaaggaccaacgtttggttagtgcgcatgcctctacgcat |
16757437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 18136387 - 18136326
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||| ||||| |||||||||||| ||||| |
|
|
| T |
18136387 |
aataccgggttcgattcccagggggaacaacacttggtcagtgtgcatgcctctacacatga |
18136326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 100 - 157
Target Start/End: Original strand, 19839325 - 19839382
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19839325 |
aaaataccggattcaattttcaggaggaacaacgcttgatcagtgcgcatgcctctac |
19839382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 35638131 - 35638082
Alignment:
| Q |
111 |
ttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
35638131 |
ttcgattttcaggaggaacaacgtttggtcagtgtgcatacctctacgca |
35638082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 121 - 184
Target Start/End: Original strand, 20255388 - 20255452
Alignment:
| Q |
121 |
aggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||||||||||||| || |||||||| | ||||||| |
|
|
| T |
20255388 |
aggacgaacaacacttgaccagtgcgcatgcctctacgcatgagtcggattagtcgtccaccttt |
20255452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 135 - 163
Target Start/End: Original strand, 22295249 - 22295277
Alignment:
| Q |
135 |
ttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22295249 |
ttggccagtgcgcatgcctctacgcatga |
22295277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 40060296 - 40060344
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatg |
150 |
Q |
| |
|
||||||||||||||||| ||| |||||||| |||||||||||||||| |
|
|
| T |
40060296 |
aataccgggttcgattttcagggggaacaacacttggccagtgcgcatg |
40060344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 135 - 163
Target Start/End: Complemental strand, 42861292 - 42861264
Alignment:
| Q |
135 |
ttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42861292 |
ttggccagtgcgcatgcctctacgcatga |
42861264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 5e-23; HSPs: 57)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 102 - 200
Target Start/End: Original strand, 5855522 - 5855621
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||||||| | ||| |||||| |
|
|
| T |
5855522 |
aataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccg |
5855621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 10422788 - 10422891
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||| | ||||||| ||| ||| |||||| |
|
|
| T |
10422788 |
aataccgggttcgatttctaggaggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccg |
10422887 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
10422888 |
gtgc |
10422891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 102 - 161
Target Start/End: Original strand, 16263545 - 16263604
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcat |
161 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16263545 |
aataccaggttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcat |
16263604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 45361990 - 45361887
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||| | | |||||||| |||||||||||| | ||| |||||| |
|
|
| T |
45361990 |
aataccgggttcgattctcaggaggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacctttagtgggtcggaaaccg |
45361891 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
45361890 |
gtgc |
45361887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 100 - 163
Target Start/End: Complemental strand, 33498949 - 33498886
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33498949 |
aaaataccgggttcgattctcaggaggagcaacgcttggccagtgcgcatgcctctacgcatga |
33498886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 49078114 - 49078217
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||| | |||||| ||||||||||||||||||||||||||||| | |||||||| |||||| || |||| ||| |||||| |
|
|
| T |
49078114 |
aataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccg |
49078213 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
49078214 |
gtgc |
49078217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 45536708 - 45536766
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
45536708 |
aataccgggttcgatttctaaggggaacaacgcttggccagtgcacatgcctctacgca |
45536766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 47313006 - 47312946
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| |||| ||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47313006 |
aataccgggtttgattcctagg-ggaacaacgtttggccagtgcgtatgcctctacgcatga |
47312946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 184
Target Start/End: Complemental strand, 11397996 - 11397914
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||||||| |||| |||||||||||||||| || |||||||| | ||||||| |
|
|
| T |
11397996 |
aataccgggttcgattccgagg-ggaacaacgtttggccaatgcgtatgcctctacgcatgagtcggattagtcgtccaccttt |
11397914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 43959929 - 43959826
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||| ||||||| ||| | ||| ||||||||| |||||||||||||||||||||||||| || | |||||||| |||||||||| ||||| |||||| |
|
|
| T |
43959929 |
aatatcgggttcaattcccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccg |
43959830 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
43959829 |
gtgc |
43959826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 125 - 187
Target Start/End: Complemental strand, 2270340 - 2270278
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatgaatcgattagtcattcacctttagt |
187 |
Q |
| |
|
||||||| |||||| | |||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
2270340 |
ggaacaatgtttggtctgtgcgcatacctctacgcatgagtcgattaatcattcacctttagt |
2270278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 100 - 157
Target Start/End: Complemental strand, 9853387 - 9853330
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
9853387 |
aaaataccgggttcgattcctaggggaaacaacgttttaccagtgcgcatgcctctac |
9853330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 10336516 - 10336577
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| |||||||||||| ||| ||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
10336516 |
aatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgcatga |
10336577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 32142954 - 32142893
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||| ||| |||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
32142954 |
aataccgggttcgattttcagggggaacaacacttggccagtgcgcatgcctttacgcatga |
32142893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 41663964 - 41663903
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
41663964 |
aataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatga |
41663903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 48798178 - 48798117
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
48798178 |
aatatcgggttcgatttccagggggaacaacgcttgactagtgcgcatgcctctacgcatga |
48798117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 127 - 163
Target Start/End: Original strand, 19195391 - 19195427
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19195391 |
aacaacgtttggccagtgcgcatgcctctacgcatga |
19195427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 6563444 - 6563499
Alignment:
| Q |
105 |
accgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||| |||| ||||||||| |
|
|
| T |
6563444 |
accgggttcgattcctagggggaacaacgcttggccagtgcacatgtctctacgca |
6563499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 17642113 - 17642054
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| |||||||||| | ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
17642113 |
aaatactgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgca |
17642054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 34877990 - 34878045
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
34877990 |
aataccaggttcgattcctaggcggaacaacacttggccagtgcgcatgcctctac |
34878045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 102 - 157
Target Start/End: Complemental strand, 40288585 - 40288530
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||| |||||||||||| |
|
|
| T |
40288585 |
aataccgggttcgatttccagggggaacaacggttggccagtatgcatgcctctac |
40288530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 93 - 160
Target Start/End: Complemental strand, 50371951 - 50371884
Alignment:
| Q |
93 |
tatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||| || ||||||||| |||| |||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
50371951 |
tatctgaaaaatagcgtgttcgattttcaggaagaacaacgcttggccagtacgcatgcttctacgca |
50371884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 121 - 163
Target Start/End: Original strand, 10507717 - 10507759
Alignment:
| Q |
121 |
aggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
10507717 |
aggaggaacaacgtttggccagtgtgcatacctctacgcatga |
10507759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 12036852 - 12036794
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||| ||||| |||| ||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
12036852 |
aatactgggtttgattcctagggggaacaatgcttggccagtgcgcatgcctctacgca |
12036794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 15465965 - 15466023
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||| |||| |||||| |||||||||||||| |
|
|
| T |
15465965 |
aataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgca |
15466023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 18915867 - 18915925
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
18915867 |
aataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgca |
18915925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 101 - 163
Target Start/End: Complemental strand, 30927836 - 30927774
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| ||||||||||||| || ||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
30927836 |
aaatatcgggttcgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatga |
30927774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 163
Target Start/End: Complemental strand, 32151023 - 32150969
Alignment:
| Q |
109 |
ggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| ||| |||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
32151023 |
ggttcgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatga |
32150969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 33418223 - 33418169
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctcta |
156 |
Q |
| |
|
|||||||| ||||||| ||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
33418223 |
aataccggattcgattcctaggggggacaacgcttggccagtgcgcatgcctcta |
33418169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 35908757 - 35908819
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacg-tttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| |||||||| |||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
35908757 |
aataccggattcgatttttagggggaacaacactttggtcagtgcgcatgcctctacgcatga |
35908819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 32871 - 32932
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||| ||||| | ||||||||||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
32871 |
aatatcgggtccgattcccaggaggaacaacgcttggtcagtgcacatgcctctacgcatga |
32932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 9659286 - 9659226
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
9659286 |
aataccgggttcgattcccagg-ggaacaacgtttgactagtgcgcatgcctttacgcatga |
9659226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 13265938 - 13265999
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| ||||||||| ||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
13265938 |
aatacctggttcgattcctagggaaaacaacgtctagccagtgcgcatgcctctacgcatga |
13265999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 93 - 158
Target Start/End: Complemental strand, 18649469 - 18649404
Alignment:
| Q |
93 |
tatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacg |
158 |
Q |
| |
|
|||||| | |||| |||||||||||| ||| ||||||||| ||| |||||||||||||||||||| |
|
|
| T |
18649469 |
tatctggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacg |
18649404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 26660138 - 26660199
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||||| | | |||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
26660138 |
aataccgggttcgatttccacggggaacaacatttgatcagtacgcatgcctctacgcatga |
26660199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 100 - 200
Target Start/End: Complemental strand, 42710248 - 42710147
Alignment:
| Q |
100 |
aaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatcg-attagtcattcacctttagtagatcgaaaac |
198 |
Q |
| |
|
|||||| |||||||||||| ||| | ||||| ||||||||||||||||||||||||||| || || ||||||| | |||| || |||||||| |||| |
|
|
| T |
42710248 |
aaaatatcgggttcgattttcaggggaaacaatacttggccagtgcgcatgcctctacgcataaaccgaattagtcgtccaccattggtagatcggaaac |
42710149 |
T |
 |
| Q |
199 |
cg |
200 |
Q |
| |
|
|| |
|
|
| T |
42710148 |
cg |
42710147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 193
Target Start/End: Complemental strand, 45726541 - 45726449
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcg |
193 |
Q |
| |
|
|||||| ||||||||| |||||||| ||| ||||||||||||| ||| |||||||||||| | |||||||| ||||||||| || ||||| |
|
|
| T |
45726541 |
aatacctggttcgattctcaggaggaataacatttggccagtgcgtatgtctctacgcatgagccggattagtcgttcacctttggtggatcg |
45726449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 50094927 - 50095007
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||||||| || |||||||| | |||| ||||| | ||| |||||||||| |
|
|
| T |
50094927 |
ggaacaacgtttgaccagtacgcatgcttctacgcatgagtcggattagtcgtccaccattagtgggtcggaaaccggtgc |
50095007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 93 - 160
Target Start/End: Original strand, 14357746 - 14357813
Alignment:
| Q |
93 |
tatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||| |||||| | ||||||||||| | | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
14357746 |
tatctggaaaatatcaggttcgatttccaattgaaacaacgtttgaccagtgcgcatgcctctacgca |
14357813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 8763991 - 8764049
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| |||||||| || | ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
8763991 |
aatatcgggttcgtttcccagggggaacaacacttggccagtgcgcatgcctctacgca |
8764049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 13262083 - 13262141
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||| || | |||||| ||||||||| |
|
|
| T |
13262083 |
aataccgggttcgatttccagggagaacaacgtttggtcaatacgcatgtctctacgca |
13262141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 16956491 - 16956549
Alignment:
| Q |
127 |
aacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttt |
184 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || | ||||||||| |||||||| |
|
|
| T |
16956491 |
aacaacgtttgaccagtgcgcatgcctctacgcacgagccggattagtcactcaccttt |
16956549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 33004123 - 33004065
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||| ||||||||| ||| | ||||| | |||||||||||||||||||||||||| |
|
|
| T |
33004123 |
aatatcggattcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgca |
33004065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 34334403 - 34334353
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcc |
152 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| |||||||||||||||||| |
|
|
| T |
34334403 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcc |
34334353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 117 - 163
Target Start/End: Complemental strand, 38791703 - 38791657
Alignment:
| Q |
117 |
ttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||| | ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
38791703 |
ttctaggggaaacaacgattggcaagtgcgcatgcctctacgcatga |
38791657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 50503469 - 50503411
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
50503469 |
aatatcgggttcgattcccagggggaacaacacttgaccagtgcgcatgcctctacgca |
50503411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 60 - 93
Target Start/End: Complemental strand, 8905314 - 8905281
Alignment:
| Q |
60 |
aaccaagttgtttggactctagtgacaaggagct |
93 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
8905314 |
aaccaagttgtttggactctagtggcaaggagct |
8905281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 163
Target Start/End: Complemental strand, 10173055 - 10173018
Alignment:
| Q |
126 |
gaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
10173055 |
gaacaacgcttggccagtgcccatgcctctacgcatga |
10173018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 21849307 - 21849255
Alignment:
| Q |
107 |
cgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||| | ||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
21849307 |
cgggttcgattcccagg-ggaacaacgcttggctagtgcgcatgcctctacgca |
21849255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 26325812 - 26325873
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| | || |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
26325812 |
aatatcgggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatga |
26325873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 117 - 158
Target Start/End: Original strand, 31734303 - 31734344
Alignment:
| Q |
117 |
ttctaggaggaacaacgtttggccagtgcgcatgcctctacg |
158 |
Q |
| |
|
||||||| | ||||||| |||||||||||||||||||||||| |
|
|
| T |
31734303 |
ttctaggggaaacaacgattggccagtgcgcatgcctctacg |
31734344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 34697335 - 34697396
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| ||||||||| |||| |||||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
34697335 |
aataccaggttcgattcttagggggaacaacacttggctagtgtgcatgcctctacgcatga |
34697396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 160
Target Start/End: Original strand, 42744799 - 42744836
Alignment:
| Q |
123 |
gaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
42744799 |
gaggaacaacgcttggccagtgagcatgcctctacgca |
42744836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 102 - 166
Target Start/End: Complemental strand, 15238214 - 15238150
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc |
166 |
Q |
| |
|
|||| ||||||||||| | ||| ||| ||||| ||||||| || ||||||||||||||| ||||| |
|
|
| T |
15238214 |
aatatcgggttcgattcccagggggagcaacgcttggccaatgagcatgcctctacgcacgaatc |
15238150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 101 - 204
Target Start/End: Complemental strand, 17092586 - 17092482
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaacc |
199 |
Q |
| |
|
||||| || ||||||||| ||| | ||||||| |||||||||| | ||||||||||||| || | |||||||| | ||||||| ||||||| ||||| |
|
|
| T |
17092586 |
aaatatcgagttcgattttcaggggaaacaacgattggccagtgtgtatgcctctacgcacgagccggattagtcgtccacctttggtagatcagaaacc |
17092487 |
T |
 |
| Q |
200 |
ggtgc |
204 |
Q |
| |
|
||||| |
|
|
| T |
17092486 |
ggtgc |
17092482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 57 - 93
Target Start/End: Complemental strand, 31576714 - 31576678
Alignment:
| Q |
57 |
ctgaaccaagttgtttggactctagtgacaaggagct |
93 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
31576714 |
ctgaaccaagttgtttgggctctagtggcaaggagct |
31576678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 107 - 163
Target Start/End: Complemental strand, 35211275 - 35211219
Alignment:
| Q |
107 |
cgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||| || |||||||| | || |||| | ||||||||||||||||||| |
|
|
| T |
35211275 |
cgggttcgatttccagaaggaacaatgcttagccaatacgcatgcctctacgcatga |
35211219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 6857 - 6960
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccg |
200 |
Q |
| |
|
|||||||||||||||| | ||| |||||||| ||||||||||||||||||||||||||||| | |||||||| |||||||| || | ||| |||||| |
|
|
| T |
6857 |
aataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccg |
6956 |
T |
 |
| Q |
201 |
gtgc |
204 |
Q |
| |
|
|||| |
|
|
| T |
6957 |
gtgc |
6960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 93 - 160
Target Start/End: Original strand, 9838 - 9905
Alignment:
| Q |
93 |
tatctgaaaaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| |||||||| ||||||||| ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9838 |
tatctgaggaataccggattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgca |
9905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0316 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0316
Description:
Target: scaffold0316; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 1721 - 1660
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
1721 |
aataccaggttcgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatga |
1660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 8808 - 8747
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
8808 |
aataccgggttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatga |
8747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 319424 - 319485
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||||||||| |||||| |||||| |
|
|
| T |
319424 |
aataccgggtttgatttctagggggaacaacgcttggccagtgcgcatccctctatgcatga |
319485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 12576 - 12636
Alignment:
| Q |
101 |
aaataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
12576 |
aaataccgggttcgattcctagg--gaacaacgcttgaccagtgcgcatgcctctacgcatga |
12636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 12672 - 12730
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
12672 |
aataccgggttcgattcagaggaggaacaacgcttggccagtgtgcatgcctctacgca |
12730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 26185 - 26243
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
26185 |
aatactgggttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacgca |
26243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 95086 - 95027
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
95086 |
aataccaggttcgatttctagga--aacaacgtttgaccagtgcgcatgcctttacgcatga |
95027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 133 - 204
Target Start/End: Original strand, 219402 - 219474
Alignment:
| Q |
133 |
gtttggccagtgcgcatgcctctacgcatgaa-tcgattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| | |||||||| | ||||||| | |||||||||||||||| |
|
|
| T |
219402 |
gtttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgc |
219474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 271181 - 271123
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
|||| ||||||||||| | ||| ||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
271181 |
aatatcgggttcgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgca |
271123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0341
Description:
Target: scaffold0341; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 18637 - 18692
Alignment:
| Q |
105 |
accgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||| |||| ||||||||| |
|
|
| T |
18637 |
accgggttcgattcctagggggaacaacgcttggccagtgcacatgtctctacgca |
18692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 5975 - 6035
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
||||| |||||||||||| ||| ||| ||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
5975 |
aatactgggttcgatttccaggggga-caacgcttggccagtgcacatgcctctacgcatga |
6035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 109 - 185
Target Start/End: Complemental strand, 25884 - 25807
Alignment:
| Q |
109 |
ggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcaccttta |
185 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||||||| |||||||| |||| | ||||||||| |||||||| |
|
|
| T |
25884 |
ggttcgattcctagggagaacaacgcttggccagtgcgcatgactctacgcgtgaaccagattagtcacccaccttta |
25807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 155809 - 155760
Alignment:
| Q |
111 |
ttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgca |
160 |
Q |
| |
|
||||||| | ||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
155809 |
ttcgattcccagggggaacaacgcttggctagtgcgcatgcctctacgca |
155760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 72634 - 72686
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctc |
154 |
Q |
| |
|
|||||||||||||||||| | | ||||||||| ||| |||||||||||||||| |
|
|
| T |
72634 |
aataccgggttcgatttccaaggggaacaacgcttgaccagtgcgcatgcctc |
72686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 25110 - 25190
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatgaatc-gattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||||| ||||| || | ||||||| || ||||| |||||||||| |
|
|
| T |
25110 |
ggaacaacatttggacagtgcgcatgtttctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgc |
25190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 65236 - 65156
Alignment:
| Q |
125 |
ggaacaacgtttggccagtgcgcatgcctctacgcatga-atcgattagtcattcacctttagtagatcgaaaaccggtgc |
204 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| | |||||||| |||| ||| ||||||| |||||||||| |
|
|
| T |
65236 |
ggaacaacgcttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgc |
65156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 8177 - 8231
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctac |
157 |
Q |
| |
|
|||||||||||||||| | | | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
8177 |
aataccgggttcgattcccaag-ggaacaacgcttggccagtgcgcatgcctctac |
8231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 42939 - 42878
Alignment:
| Q |
102 |
aataccgggttcgatttctaggaggaacaacgtttggccagtgcgcatgcctctacgcatga |
163 |
Q |
| |
|
|||| ||||||||||| ||||| |||||| | |||| |||||||||||||||||| ||||| |
|
|
| T |
42939 |
aatatcgggttcgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatga |
42878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University