View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4786_low_1 (Length: 344)
Name: NF4786_low_1
Description: NF4786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4786_low_1 |
 |  |
|
| [»] chr1 (7 HSPs) |
 |  |
|
| [»] chr4 (5 HSPs) |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 7009007 - 7009063
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7009007 |
agagtttttctaatcacaccctgtttaatcctggttacaccccaaaataacaaaatt |
7009063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 288 - 335
Target Start/End: Original strand, 32086481 - 32086528
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
32086481 |
agagtttttctaattacaccctgtttaatcctgattgcaccccaaaat |
32086528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 288 - 344
Target Start/End: Complemental strand, 24527721 - 24527665
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
24527721 |
agagtttttctaatcacaccctgtttaatcctgattgcattccaaaatgccaaaatt |
24527665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 335
Target Start/End: Original strand, 41712764 - 41712806
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
41712764 |
ttttctaattacaccctgtttaatcctggttgcaccccaaaat |
41712806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 40498616 - 40498672
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||| ||| || ||||||||||| ||||||| |
|
|
| T |
40498616 |
agagtttttctaattacaccctgtttaattctggttgcaccccaaaatgacaaaatt |
40498672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Complemental strand, 51002117 - 51002061
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
51002117 |
agagtttttctaattataccctgtttaatcctgattgcaccctaaaatgacaaaatt |
51002061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 51776028 - 51776084
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || || |||||||| ||||||| |
|
|
| T |
51776028 |
agagtttttctaattacaccctgtttaatcctggttgcatcccaaaatgacaaaatt |
51776084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 293 - 344
Target Start/End: Complemental strand, 22301838 - 22301787
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||| ||||||| |
|
|
| T |
22301838 |
ttttctaatcacaccctgtttaatcctggttgcaccccaaaataacaaaatt |
22301787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 293 - 344
Target Start/End: Complemental strand, 37683355 - 37683304
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||| |||||||| |
|
|
| T |
37683355 |
ttttctaatcacaccctgtttaatcctggttacactccaaaatgtcaaaatt |
37683304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 293 - 344
Target Start/End: Original strand, 8713228 - 8713279
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
8713228 |
ttttctaatcacaccctgtttaatccttgttacaccccaaaatgacaaaatt |
8713279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 24896984 - 24897040
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24896984 |
agagtttttctaattacaccttgtttaatcctggttacaccccaaaatgacaaaatt |
24897040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 288 - 335
Target Start/End: Original strand, 22847103 - 22847150
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
22847103 |
agagtttttctaattacaccctgtttaatcctggttgcaccccaaaat |
22847150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 6925776 - 6925832
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
6925776 |
agagtttttctaattacaccctgtttaatcctgattgcaccccaaaatgacaaaatt |
6925832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 288 - 335
Target Start/End: Original strand, 23350353 - 23350400
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
23350353 |
agagtttttctaattacaccctgtttaatcctggttgcaccccaaaat |
23350400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Complemental strand, 31091230 - 31091174
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||| || ||||||||||| ||||||| |
|
|
| T |
31091230 |
agagtttttctaattacaccatgtttaatcctggttgcaccccaaaatgacaaaatt |
31091174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 288 - 336
Target Start/End: Original strand, 10594083 - 10594131
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaata |
336 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || |||||||||||| |
|
|
| T |
10594083 |
agagtttttctaattacaccctgtttaatcctggttgcaccccaaaata |
10594131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 24980854 - 24980910
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || ||||| ||||| ||||||| |
|
|
| T |
24980854 |
agagtttttctaattacaccctgtttaatcctggttgcaccctaaaatgacaaaatt |
24980910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 26170975 - 26171031
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| || || |||||||||||| ||||||| |
|
|
| T |
26170975 |
agagtttttctaattacaccctgtttaatcttggttgcaccccaaaataacaaaatt |
26171031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 335
Target Start/End: Complemental strand, 45443636 - 45443594
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| |||||| |
|
|
| T |
45443636 |
ttttctaattacaccatgtttaatcctgattacacctcaaaat |
45443594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 293 - 344
Target Start/End: Original strand, 12722560 - 12722611
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
12722560 |
ttttctaattacaccctgtttaatcctggttgcaccccaaaatgacaaaatt |
12722611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 293 - 344
Target Start/End: Complemental strand, 31793929 - 31793878
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
31793929 |
ttttctaattacaccctgtttaatcctggttgcaccccaaaatgacaaaatt |
31793878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Complemental strand, 41942446 - 41942390
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || || |||||||| ||||||| |
|
|
| T |
41942446 |
agagtttttctaattacaccctgtttaatcctggttgcatcccaaaatgacaaaatt |
41942390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 288 - 335
Target Start/End: Complemental strand, 12189392 - 12189345
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
12189392 |
agagtttttctaattacaccttgtttaatcctggttacaccccaaaat |
12189345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 335
Target Start/End: Original strand, 18978454 - 18978496
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
18978454 |
ttttctaattacaccctgtttaatcctggttgcaccccaaaat |
18978496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 335
Target Start/End: Complemental strand, 43548664 - 43548622
Alignment:
| Q |
293 |
ttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
43548664 |
ttttctaattacaccctgtttaatcctggttgcaccccaaaat |
43548622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Complemental strand, 10666223 - 10666167
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| |||| |||| |||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
10666223 |
agagtttttataattacaccctgtttaatcctggttgcaccccaaaatgacaaaatt |
10666167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 18864429 - 18864485
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || ||||| ||||| ||||||| |
|
|
| T |
18864429 |
agagtttttctaattacaccctgtttaatcctggttgcaccctaaaatgacaaaatt |
18864485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 36294180 - 36294236
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||| || |||||||||||||| ||||||| |
|
|
| T |
36294180 |
agagtttttctaattacaccatgtttaatcatggttacaccccaaaatgacaaaatt |
36294236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Original strand, 40738891 - 40738947
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || ||||| ||||| ||||||| |
|
|
| T |
40738891 |
agagtttttctaattacaccctgtttaatcctggttgcaccctaaaatgacaaaatt |
40738947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 288 - 335
Target Start/End: Complemental strand, 44354596 - 44354549
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaat |
335 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
44354596 |
agagtttttctaattacaccctgtttaatcctggttgcaccccaaaat |
44354549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 344
Target Start/End: Complemental strand, 36885838 - 36885782
Alignment:
| Q |
288 |
agaggttttctaatcacaccctgtttaatcctgattacaccccaaaatatcaaaatt |
344 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || ||||| ||||| ||||||| |
|
|
| T |
36885838 |
agagtttttctaattacaccctgtttaatcctggttgcaccctaaaatgacaaaatt |
36885782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University