View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4788-Insertion-6 (Length: 193)
Name: NF4788-Insertion-6
Description: NF4788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4788-Insertion-6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 8 - 193
Target Start/End: Complemental strand, 5832569 - 5832384
Alignment:
| Q |
8 |
ctcaaacctagaaatttatacaattttcattcaagtaactgagtttaccgggtattgaagagtaaattagcattttggcgttcgaatttgttaaagtcgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5832569 |
ctcaaacctagaaatttatacaattttcattcaagtaactgagtttaccgggtattgaagagtaaattagcattttggtgttcgaatttgttaaagtcgg |
5832470 |
T |
 |
| Q |
108 |
tcaatttagattctcaaatttacaaaatagcaatttagtcttttgaattgaagaatatcatgcaattaggtttcttaatctaaata |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5832469 |
tcaatttagattctcaaatttacaaaatagcaatttagtcttttgaattaaagaatatcatgcaattaggtttcttaatctaaata |
5832384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 120 - 167
Target Start/End: Complemental strand, 5086104 - 5086057
Alignment:
| Q |
120 |
ctcaaatttacaaaatagcaatttagtcttttgaattgaagaatatca |
167 |
Q |
| |
|
||||||||||||||||||||| |||||| ||| |||| |||||||||| |
|
|
| T |
5086104 |
ctcaaatttacaaaatagcaaattagtcctttaaattaaagaatatca |
5086057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University