View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4788-Insertion-7 (Length: 247)
Name: NF4788-Insertion-7
Description: NF4788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4788-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 35445032 - 35444793
Alignment:
| Q |
8 |
gagaccaatgagatttatcagtatttggacgggttgatatggaggtgcaaggaagcgggttatgcaccaattcctgaatcagcaatgcacgagttggaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35445032 |
gagaccaatgagatttatcagtatttggacgggttgatatggaggtgcaaggaagcgggttatgcaccaattcctgaatcagcaatgcacgagttggaag |
35444933 |
T |
|
| Q |
108 |
aagaagagagggagtatgccctcagacaccatagtgagaagcttgcagtagcatttgggctgatgaaaactagtgatggaacggcgctcaagattgtcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35444932 |
aagaagagagggagtatgccctcagacaccatagtgagaagcttgcagtagcatttgggctgatgaaaactagtcatggaacggcgctcaagattgtcaa |
35444833 |
T |
|
| Q |
208 |
gaaccttaggatatgtgaagactgtcattcggcaattaag |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35444832 |
gaaccttaggatatgtgaagactgtcattcggcaattaag |
35444793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University