View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4788_low_8 (Length: 227)

Name: NF4788_low_8
Description: NF4788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4788_low_8
NF4788_low_8
[»] chr3 (1 HSPs)
chr3 (7-223)||(8822368-8822584)


Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 8822584 - 8822368
Alignment:
7 agattgaattctcagcgaggttcagaacagtcagtcgttgtaactttccaatgttcaccggaatttttccggtgagctggtttccgataagatccaaaat 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8822584 agattgaattctcagcgaggttcagaacagtcagtcgttgtaactttccaatgttcaccggaatttttccggtgagctggtttccgataagatccaaaat 8822485  T
107 gcggagattggagagagaagtgagacattgtggaatctcaccggagatagctttccaatcggcgagtatgaaggaagtgaggctgtcaattttgcaaatc 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8822484 gcggagattggagagagaagtgagacattgtggaatctcaccggagatagctttccaatcggcgagtatgaaggaagtgaggctgtcaattttgcaaatc 8822385  T
207 tccggtgagatttttcc 223  Q
    |||||||||||||||||    
8822384 tccggtgagatttttcc 8822368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University