View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_high_16 (Length: 341)
Name: NF4789_high_16
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 29607328 - 29606989
Alignment:
| Q |
1 |
atccagaccaaagaggtccgtaaatatagaattgtaacttaaagtaaaatggaaaaggatattaccgcactgggactgggtgctggtgacggtccttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607328 |
atccagaccaaagaggtccgtaaatatagaattgtaacttaaagtaaaatggaaaaagatattaccgcactgggactgggtgctggtgacggtccttcat |
29607229 |
T |
|
| Q |
101 |
ctgaactcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607228 |
ctgaactcattgtagtattatcatcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgc |
29607129 |
T |
|
| Q |
201 |
gtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgct------ |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607128 |
gtgatgtttcttatgcttactatgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgct |
29607029 |
T |
|
| Q |
295 |
------ggtgtgtctattgcaggtgttggtgcaggtgatg |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29607028 |
gatgatggtgtgtctattgcaggtgttggtgcaggtgatg |
29606989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University