View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_high_20 (Length: 291)
Name: NF4789_high_20
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 19 - 274
Target Start/End: Original strand, 48487196 - 48487451
Alignment:
| Q |
19 |
aatatcacccaaatgaaaatccactagtttgaaaatctctttcccttttttacccttttcatcaaaacaatttccactctccactttaaccaataacata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48487196 |
aatatcacccaaatgaaaatccactagtttgaaaatctctttcccttttttacccttttcatcaaaacaatttccactctccgctttaaccaataacatt |
48487295 |
T |
|
| Q |
119 |
cgactccctttaaccgtctttttaatgctcttaaacgacttagcatgcttctcataatcaaattcatcaaaaccattatcactctcttttttcggatcgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48487296 |
cgactccctttaaccgtctttttaatgctcttaaacgacttagcatgcttctcataatcaaattcatcaaaaccattatcactctcttttttcggatcgc |
48487395 |
T |
|
| Q |
219 |
gtttgttttcctttcccttatttacaaatctaattccagtgtcactactctcacct |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
48487396 |
atttgttttcctttcccttatttacaaatctaattacagtatcactactctcacct |
48487451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University