View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_high_25 (Length: 247)
Name: NF4789_high_25
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 5253761 - 5253534
Alignment:
| Q |
1 |
attatgactgaactgcttttatttattcacttagaaaattgaatattcaacttttcttcaagaattgaaacgagtcggcaaacattaaaaaacattttta |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
5253761 |
attaggactgaactgcttttatttattcacttagaaaattgaatattcaacttttcttcaagaattaaaacgagtcgtcaaacattaaaaaatattttta |
5253662 |
T |
 |
| Q |
101 |
ggaaaatgtggtaatactttcattttcccaaaatattaaaccaagtgatcgagcaatgaaacatatacatgacaaaattaagtgatttttataaagttga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5253661 |
ggaaaatgtgataatactttcattttcccaaaatattaaaccaagtgatcgaccaatgaaacatatacatgacaaaattaagtgatttttataaagttga |
5253562 |
T |
 |
| Q |
201 |
ttattcttcttgagatctaggataggtt |
228 |
Q |
| |
|
||||||||||| ||||||||||||||| |
|
|
| T |
5253561 |
ttattcttcttatgatctaggataggtt |
5253534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University