View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_low_11 (Length: 401)
Name: NF4789_low_11
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 14 - 385
Target Start/End: Complemental strand, 34511819 - 34511444
Alignment:
| Q |
14 |
cacagaccagatagctaattcttgtaaaacgaaacaacttcaaagaatatatggagaaaagagagcaatggcagtagaattggtgattaccaaagattga |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||| |
|
|
| T |
34511819 |
cacaaaccagatagctaattcttgtaaaacgaaacaacttcaaagaatatatggagaaaagagagcaatggcagtagaatagatgattaccaaagactga |
34511720 |
T |
 |
| Q |
114 |
gctgcagagaaaatattgccagcaactagagcttcaaagcggcaaggaacaagatcagccacatagatattgactcccatcctcacata----acagtga |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
34511719 |
actgcagagacaatattgccagcaactagagcttcaaagcggcaaggaacaagatcagccacatagatattgactcccatcctcacgtatacgacagtga |
34511620 |
T |
 |
| Q |
210 |
aatacaaaatccaatagagcacgatcgcaaaaagaagtagattgcacttgaaagtcaccaacaaattgataactccaaatcttcaaaaataatcaaaact |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34511619 |
aatacaaaatccaatagagcacgatcgcaaaaagaagtagattgcacttgaaagtcactaacaaattgataactccaaatcttcaaaaataatcaaaaat |
34511520 |
T |
 |
| Q |
310 |
gaatctccatctaaaacttccaaaatcaagaattctccataaatctctcaaaacaaacaacctgcactgtcaaacc |
385 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34511519 |
gaatctccatctataacttccagaatcaagaattctccataaatctctcaaaacaaacaacctgcacggtcaaacc |
34511444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University