View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_low_16 (Length: 363)
Name: NF4789_low_16
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-134; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 19 - 285
Target Start/End: Original strand, 22945243 - 22945509
Alignment:
| Q |
19 |
atggttgacagagaaattctcattatacaaacctcttcagtaaaaaattaagtgtgatatgcaggcgcaaaattacaaatatgtataaactaattagttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||| |
|
|
| T |
22945243 |
atggttgacagagaaattctcattatacaaacctcttcagtaaaaaattaagtgtgatatgcgggcgcaaaattacaactatgtataaactaattatttt |
22945342 |
T |
|
| Q |
119 |
tggcagagaacctgtttcgtaaagcttggcattttggaattctatgtttcgtgggtatgttgccaatggagattatgttgtggctctaagtatgatttct |
218 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22945343 |
tggcatagaacctgtttcataaagcttggcattttggaattctatgtttcgtgggtatgttgccaattgagattatgttgtggctctaagtatgatttct |
22945442 |
T |
|
| Q |
219 |
caaatgcaggaagccggaaagcgccagaatacaaacaggaaggaaaaaagcctaaagaattttactc |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22945443 |
caaatgcaggaagccggaaagcgccagaatacaaacaggaaggaaaaaagcctaaagaattttactc |
22945509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 130 - 226
Target Start/End: Original strand, 32816155 - 32816251
Alignment:
| Q |
130 |
ctgtttcgtaaagcttggcattttggaattctatgtttcgtgggtatgttgccaatggagattatgttgtggctctaagtatgatttctcaaatgca |
226 |
Q |
| |
|
|||||||| ||||||||||| | |||||||| ||| || |||| |||||| ||||||||||||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
32816155 |
ctgtttcggaaagcttggcactatggaattcgatgctttctgggcatgttgtcaatggagattatgttgaggctctcagtatgatttctcatatgca |
32816251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 303 - 353
Target Start/End: Original strand, 22945619 - 22945668
Alignment:
| Q |
303 |
aaagctcttgaaacttgtctaaaatatgtctaattcattggtgttgatgat |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22945619 |
aaagctcttgaaacttgtctaaaatatgtc-aattcattggtgttgatgat |
22945668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University