View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_low_20 (Length: 351)
Name: NF4789_low_20
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 17 - 321
Target Start/End: Complemental strand, 40518287 - 40517983
Alignment:
| Q |
17 |
tcaaactagcaagggagaaattacggacatgggatgatcctggcatattatcatcaatatatatgcgcacgttagattatttaattttcaattgtataag |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40518287 |
tcaaactagcaagggaaaaattacggacatgggatgatcctggcatattatcatcaatatatatgcgcacattagattatttaattttcaattgtataag |
40518188 |
T |
 |
| Q |
117 |
atagttcgggtctcatctattttaactagttatggaaccagatttaactactagtcgtgagaggaatttttcatggtatattataactctatccaactcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40518187 |
atagttcgggtctcatctattttaactagttatggaaccagatttaactactagtcgtgagaggaatttttcatcgtatattataactctatccaactcg |
40518088 |
T |
 |
| Q |
217 |
agatattagtatttatagatgcaggagagcatatcctatttcgtaaattatagtattaaggaggaattaattcattggctgcggatgataaaggcaaggc |
316 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40518087 |
agatattagtatttatagatgcaagagagcatatcctatttcgtaaattatagtattaaggaggaattaattcattggctgcggatgataaaggcaaggc |
40517988 |
T |
 |
| Q |
317 |
aatta |
321 |
Q |
| |
|
||||| |
|
|
| T |
40517987 |
aatta |
40517983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University