View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_low_27 (Length: 272)
Name: NF4789_low_27
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 260
Target Start/End: Complemental strand, 10584397 - 10584156
Alignment:
| Q |
19 |
gtaatatagttcccgtttagattattgatattgttgcacctaattcaaagggtccttctgtaatgtagggactacatagcaatagatattattgatagta |
118 |
Q |
| |
|
||||||||||| ||| |||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10584397 |
gtaatatagttgccgcttagattattaatattgttacacctaattcaaagggtccttctataatgtagggactacgtagcaatagatattattgatagta |
10584298 |
T |
 |
| Q |
119 |
tcgctcaattatagaccaaatttgcaactacttaattgctttgatggtgtgtattgttatggtggaggcatatgtggtttttgtcgaagtatcttgttcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10584297 |
tcgctcaattatagaccaaatttgcaactacttaattgctttgatggtgtgtattgttatggtggaggcatatgtggtttttgtcgaagtatcttgttcc |
10584198 |
T |
 |
| Q |
219 |
tttttagggcaggttcatttgatatgaagtcatagtgatgat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10584197 |
tttttagggcaggttcatttgatatgaagtcatagtgatgat |
10584156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University