View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_low_39 (Length: 219)
Name: NF4789_low_39
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 53453898 - 53453708
Alignment:
| Q |
19 |
ttttcaccctactagttgcaatcgggatctgtttacttccgacatttgcttatatttccattatgaagaacttctattagcatttccctttcaaaagttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53453898 |
ttttcaccctactagttgcaatcgggatctgtttacttccgacatttgcttatatttccattatgaagaacttccattagcatttccctttcaaaagttg |
53453799 |
T |
 |
| Q |
119 |
aaaatttcattttctacatggaagacctcttccagtcctttaccatatggaaatctctacagtctgcagtctgtttttattcatgatgatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453798 |
aaaatttcattttctacatggaagacctcttacagtcctttaccatatggaaatctctacagtctgcagtctgtttttattcatgatgatg |
53453708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 121
Target Start/End: Original strand, 7514 - 7558
Alignment:
| Q |
77 |
cattatgaagaacttctattagcatttccctttcaaaagttgaaa |
121 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
7514 |
cattttgaagaacttctataagcattaccctttcaaaagatgaaa |
7558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University