View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4789_low_40 (Length: 215)

Name: NF4789_low_40
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4789_low_40
NF4789_low_40
[»] chr7 (1 HSPs)
chr7 (18-115)||(48008414-48008511)
[»] chr4 (1 HSPs)
chr4 (29-102)||(29921223-29921294)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 48008511 - 48008414
Alignment:
18 agtacatgtcctacttagatctagtagtgctttgttttttatgtgcatctgtgtgtcacaaagatgttgagtaatctccaaatcattatatttggtta 115  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48008511 agtacatgccctacttagatctagtagtgctttgttttttatgtgcatctgtgtgtcacaaagatgttgagtaatctccaaatcattatatttggtta 48008414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 29921294 - 29921223
Alignment:
29 tacttagatctagtagtgctttgttttttatgtgcatctgtgtgtcacaaagatgttgagtaatctccaaatca 102  Q
    |||||||||||||||||||  ||||| ||||||||||||  |||||| |||||||||||| ||||||| |||||    
29921294 tacttagatctagtagtgccatgtttgttatgtgcatct--gtgtcagaaagatgttgaggaatctcctaatca 29921223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University