View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_low_40 (Length: 215)
Name: NF4789_low_40
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 48008511 - 48008414
Alignment:
| Q |
18 |
agtacatgtcctacttagatctagtagtgctttgttttttatgtgcatctgtgtgtcacaaagatgttgagtaatctccaaatcattatatttggtta |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48008511 |
agtacatgccctacttagatctagtagtgctttgttttttatgtgcatctgtgtgtcacaaagatgttgagtaatctccaaatcattatatttggtta |
48008414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 29921294 - 29921223
Alignment:
| Q |
29 |
tacttagatctagtagtgctttgttttttatgtgcatctgtgtgtcacaaagatgttgagtaatctccaaatca |
102 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||||| |||||||||||| ||||||| ||||| |
|
|
| T |
29921294 |
tacttagatctagtagtgccatgtttgttatgtgcatct--gtgtcagaaagatgttgaggaatctcctaatca |
29921223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University