View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4789_low_7 (Length: 424)
Name: NF4789_low_7
Description: NF4789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4789_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 14 - 414
Target Start/End: Original strand, 41743849 - 41744249
Alignment:
| Q |
14 |
gaagaaaccaaaagaacgccgtccttttctcgcttctgaatgtcgtgacctaaacgaagccgacaaatggcgtcagcaaatcatgcgcgaaatcggccgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41743849 |
gaagaaaccaaaagaacgccgtccttttctcgcttctgaatgtcgtgacctaaacgaagccgacaaatggcgtcagcaaatcatgcgcgaaatcggccgc |
41743948 |
T |
 |
| Q |
114 |
aaagtcgccgagattcaaaacgaaggtctcggcgaacaccgtcttcgtgatctcaacgacgaaattaacaaactcattcgtgagaaatcgcattgggaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41743949 |
aaagtcgccgagattcaaaacgaaggtctcggcgaacaccgtcttcgtgatctcaacgacgaaattaacaaactcattcgtgagaaatcgcattgggaga |
41744048 |
T |
 |
| Q |
214 |
ggagaattgttgagcttggaggaccgaattacgctaggcattctgcgaaaatgactgatttggatgggaatattgttgatgtccctaaccctagtggaag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744049 |
ggagaattgttgagcttggaggaccgaattacgcgaggcattctgcgaaaatgactgatttggatgggaatattgttgatgtccctaaccctagtggaag |
41744148 |
T |
 |
| Q |
314 |
ggggccggggtatagatatttcggtgcagcgaagaaattgcctggggttagggagctttttgagaagccgccggagttgaggaaacgaaggacgagatat |
413 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744149 |
ggggcccgggtatagatatttcggtgcagcgaagaaattgcctggggttagggagctttttgagaagccgccggagttgaggaaacgaaggacgagatat |
41744248 |
T |
 |
| Q |
414 |
g |
414 |
Q |
| |
|
| |
|
|
| T |
41744249 |
g |
41744249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University