View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4791-Insertion-7 (Length: 398)
Name: NF4791-Insertion-7
Description: NF4791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4791-Insertion-7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 226 - 379
Target Start/End: Original strand, 34551693 - 34551846
Alignment:
| Q |
226 |
aagagtttaacctcgatgtgtccctcccaaaccattctctgactcccatggattttgatattttgaatggaatacatatttaaaatgatcgagttttagt |
325 |
Q |
| |
|
||||||||||||||||||||| |||| | ||||||||| ||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34551693 |
aagagtttaacctcgatgtgtacctctccaaccattctatgactcccatggaatttgatattttgaatgaaatacatgtttaaaatgatcgagttttagt |
34551792 |
T |
|
| Q |
326 |
tatttagaatggaatatgatattttgaacggaataaatatttagttattaaaaa |
379 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34551793 |
tatttagaatggaatatgatattttgaatataataaatatttagttattaaaaa |
34551846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 113 - 233
Target Start/End: Original strand, 34551134 - 34551254
Alignment:
| Q |
113 |
ttaaaggtgagcccttatttgcaagatcaaccatttaaatagtcattacttgataggcgagaatccacgtcgagttttaggaaactcattgaattgttat |
212 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34551134 |
ttaaaggtgagcccccatttgcacaatcaaccctttaaatagtcatcacttgttaggtgagaatccacgtcgagttttaggaaactcattgaattgttat |
34551233 |
T |
|
| Q |
213 |
ttttgttggaggaaagagttt |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34551234 |
ttttgttggaggaaagagttt |
34551254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 33 - 112
Target Start/End: Original strand, 34551018 - 34551097
Alignment:
| Q |
33 |
atatgtggttgctaaaaatagagaatatcaattttgtcaatgttcaaagatttggacaaattaatagcttagagcaagcc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34551018 |
atatgtggttgctaaaaatagagaatatcaattttgtcaatgttcaaagatttgaacaaattaatagcttagagcaagcc |
34551097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University