View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4791-Insertion-8 (Length: 393)
Name: NF4791-Insertion-8
Description: NF4791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4791-Insertion-8 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 53 - 393
Target Start/End: Complemental strand, 29929513 - 29929173
Alignment:
| Q |
53 |
tgtgtatgtgtgcgtcttactaatgtgtttggtgctcattagattgcggatgacagcccaggcaagggcatattagatgagctacgcactgatggtgtgg |
152 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29929513 |
tgtgtatgtgtgcgttttactaatgtgtttggtgctcattagattgcggatgacagcccaggcaagggcatattagatgagctacgcactgatggtgtgg |
29929414 |
T |
|
| Q |
153 |
atacatcttttattgtggtaattgtttcaacacttttttctctttaattgtatttgcaaacttcatgaagcttgaaatttggattattgctttttggtat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29929413 |
atacatcttttattgtggtaattgtttcaacacttttttctctttaattgtatttgcaaacttcatgatgcttgaaatttggattattgctttttggtat |
29929314 |
T |
|
| Q |
253 |
ctgtggtaagatttgatttgttgctcatgccttttagttatggacaacaatataatcatgtgatgaaagtacatgatccctagtctagatttctccactt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29929313 |
ctgtggtaagatttgatttgttgctcatgccttttagttatgggcaacaatataatcatgtgatgaaagtacatgatccctagtctagatttctccacgt |
29929214 |
T |
|
| Q |
353 |
ctgcacctgatttcttgcacatccactctcaaatctcagta |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29929213 |
ctgcacctgatttcttgcacatccactctcaaatctcagta |
29929173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 29929676 - 29929630
Alignment:
| Q |
8 |
agactattgtggaaagtttatgcgaaatatgctgaaaacaacttatg |
54 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29929676 |
agactactgtggaaagtttatgtgaaatatgctgaaaacaacttatg |
29929630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University