View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4791-Insertion-9 (Length: 241)
Name: NF4791-Insertion-9
Description: NF4791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4791-Insertion-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 241
Target Start/End: Complemental strand, 48869166 - 48868932
Alignment:
| Q |
8 |
atatatagcattatgcatttcaatgagatgggtggttcagggacacattgtgaatacattcttgattgttgaggcacttgaaggatctttctcttcttat |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48869166 |
atatataacattatgcatttcaatgagatgggtggttcagggaggcattgtgaatacattcttgattgttgaggcacttgaaggatctttctcttcttat |
48869067 |
T |
 |
| Q |
108 |
gtgaatctagtatttagaatcacgttgaaactcttttcaaactcatgatgagagtgacactactatctgtagcttaaatgttaatgaacaatgggagtga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48869066 |
gtgaatctagtatttagaatcacgttgaaactcttttcaaactcatgatgagagtgacactactatctgtagcttaaatgttaatgaacaatggaagtga |
48868967 |
T |
 |
| Q |
208 |
aataaccgtg-tttcatagtttgaagttggtttca |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
48868966 |
aataaccgtgttttcatagtttgaagttggtttca |
48868932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University