View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4792-Insertion-6 (Length: 217)
Name: NF4792-Insertion-6
Description: NF4792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4792-Insertion-6 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 217
Target Start/End: Complemental strand, 29332440 - 29332229
Alignment:
| Q |
8 |
gccattgcttcaattgcagagaaaaacctcaacgggatggtacgtataattcgatatgatattcaatgagctttaaatccata--gtgttttcttgatca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29332440 |
gccattgcttcaattgcagagaaaaacctcaacgagatggtatgtataattcgatatgatattcaatgagctttaaatccataaagtgttttcttgatca |
29332341 |
T |
|
| Q |
106 |
tgcattaccttgtagaaagagcaatcatgtcatgtaaattcaatagatacttcaacagattctgatgggacacttcaaagttttgcatgatttctgtgtc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29332340 |
tgcattaccttgtagaaagagcaatcatgtcatgtaaattcaatagatacttcaacagattctgatgggacacttcaaagttttgcatgatttctgtgtc |
29332241 |
T |
|
| Q |
206 |
ttctattttgta |
217 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29332240 |
ttctattttgta |
29332229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 140
Target Start/End: Complemental strand, 29303996 - 29303948
Alignment:
| Q |
92 |
tgttttcttgatcatgcattaccttgtagaaagagcaatcatgtcatgt |
140 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29303996 |
tgttttttcgatgatgcattaccttgtagaaaaagcaatcatgtcatgt |
29303948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University