View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4792_high_5 (Length: 202)
Name: NF4792_high_5
Description: NF4792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4792_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 44708043 - 44708207
Alignment:
| Q |
20 |
gtcatcacagaaaatcaaccaccatagaggcatcaacctcccccggaggttgaannnnnnnnaaacaagaacatatatagataccgaattcacgaccaaa |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44708043 |
gtcattacagaaaatcaaccaccatagaggcatcaacctccc--ggaggttgaatttgctttaaacaagaacatatatagataccgaattcacgaccaaa |
44708140 |
T |
 |
| Q |
120 |
tttgtttttacttgacgagatgaatacttgcttgctttcggtccagatacatattgtccagattcat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44708141 |
tttgtttttacttgacgagatgaatacttgcttgctttcggtccagatacatattgtccagaatcat |
44708207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University