View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4792_low_1 (Length: 301)
Name: NF4792_low_1
Description: NF4792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4792_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 135 - 294
Target Start/End: Original strand, 28163820 - 28163979
Alignment:
| Q |
135 |
gtcatcttcgtcaagattctcttggccatgaggttgaatttcaaattgtagacctacactttccattccattttcaacatctcgtgcatcctcggaattt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28163820 |
gtcatcttcgtcaagattctcttggccatgaggttgaatttcaaattgtagacctacactttccattccattttcaacatctcgtgcatcctcggaattt |
28163919 |
T |
 |
| Q |
235 |
tcatgcatgtaatcatcctcgttagaaggagcaaagttcccatcaagatcttgatgatgt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28163920 |
tcatgcatgtaatcatcctcgttagaaggagcaaagttcccatcaagatcttgatcatgt |
28163979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 28163686 - 28163754
Alignment:
| Q |
1 |
atctcatggtcatcttgatctgtgtcaggatgtggcaagtgatggacttcatgttccaagtcattatgc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28163686 |
atctcatggtcatcttgatctgtgtcaggatgtggcaagtgatggacttcatgttccaagtcattatgc |
28163754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 45771272 - 45771229
Alignment:
| Q |
4 |
tcatggtcatcttgatctgtgtcaggatgtggcaagtgatggac |
47 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45771272 |
tcatgatcatcttgatctgtgtcaggatgtggcaagtgatggac |
45771229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University