View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4792_low_5 (Length: 231)
Name: NF4792_low_5
Description: NF4792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4792_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 173
Target Start/End: Original strand, 42422694 - 42422850
Alignment:
| Q |
17 |
accaatgacggtggtagccttagaccatagaccatggcttgccttcaaccttcaacaaagaatcctgtcttagaccacaggctatgcttgccttcaagct |
116 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
42422694 |
accaatggcagtggtagccttagaccatagaccatggcttgccttcaaccttcaacagagaatcctgccttagaccacaaactatgcttgccttcaagct |
42422793 |
T |
 |
| Q |
117 |
tcaacagagaatcacaatgaattgaaatgtaattcaagatcaaattcatcgactata |
173 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
42422794 |
tcaacacagaatcacaatgaattgaaatgcaattcaaaatcaaattcatcgactata |
42422850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University