View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4793-Insertion-25 (Length: 229)
Name: NF4793-Insertion-25
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4793-Insertion-25 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 229
Target Start/End: Original strand, 36145505 - 36145724
Alignment:
| Q |
8 |
agcgttgcaaagacgacgattcctccgcaattttaagaagttgtatacgccaaatttccccctaaacacatgtctagattcactccaaagtgggaacaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36145505 |
agcgttgcaaagacgacgattcctccgcaattttaagaagttttatac-ccaaattttcccctaaacacatgtctagattcactccaacctgggaacaaa |
36145603 |
T |
|
| Q |
108 |
aacttcctaagaaaatgttagaaagtcttgaattcaaagccgattgcataaagagaaggggaaatcaaagctgaatataattcttatacgagctatactt |
207 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
36145604 |
aactccccaagaaaatgttagaaagtcttgaattcaaagccgattgcataaagagaaaaggaaatcaaagctgaatataattctaatacgagctatac-t |
36145702 |
T |
|
| Q |
208 |
ttatttatttattttaggatta |
229 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36145703 |
ttatttatttattttaggatta |
36145724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University