View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4793-Insertion-29 (Length: 136)
Name: NF4793-Insertion-29
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4793-Insertion-29 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 6 - 136
Target Start/End: Complemental strand, 44952348 - 44952218
Alignment:
| Q |
6 |
cagcaacaacaacggcaacaaattacggcgatgtcaagaagtagaacgctgaatcttagacgatcggcgatgaagaattcgttgattcgaatcggtgtag |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952348 |
cagcagcaacaacggcaacaaattacggcgatgtcaagaagtagaacgctgaatcttagacgatcggcgatgaagaattcgttgattcgaatcggtgtag |
44952249 |
T |
|
| Q |
106 |
aaggtgaaattttgaagagaacgttaacgaa |
136 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
44952248 |
aaggtgaaattttgaagagaacattaacgaa |
44952218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University