View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4793_high_27 (Length: 239)
Name: NF4793_high_27
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4793_high_27 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 18 - 105
Target Start/End: Original strand, 22616700 - 22616787
Alignment:
| Q |
18 |
gtttaagatcatcatcgtaatcattcaaattgaaatttatgtcagcaccaactcccctaaacttaatagcagctcgatcgtaggctct |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22616700 |
gtttaagatcatcatcgtaatcattcaaattgaaatttatgtcagcaccaactcccctaaacttaatagcagctcgatcataggctct |
22616787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 181 - 239
Target Start/End: Original strand, 22616868 - 22616926
Alignment:
| Q |
181 |
gatttacctagcagcagcatgagctgtgtcaaatccacctacaaaattcaaccacaaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22616868 |
gatttacctagcagcagcatgagctgtgtcaaatccacctacaaaattcaaccacaaat |
22616926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 105
Target Start/End: Original strand, 21890774 - 21890861
Alignment:
| Q |
18 |
gtttaagatcatcatcgtaatcattcaaattgaaatttatgtcagcaccaactcccctaaacttaatagcagctcgatcgtaggctct |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |||||||| |
|
|
| T |
21890774 |
gtttaagatcatcatcataatcattcaaattgaaatttatgtcagcaccaactcccctgaatttaatcgcagctcgatcataggctct |
21890861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 46007912 - 46007825
Alignment:
| Q |
18 |
gtttaagatcatcatcgtaatcattcaaattgaaatttatgtcagcaccaactcccctaaacttaatagcagctcgatcgtaggctct |
105 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||| |||||||| |
|
|
| T |
46007912 |
gtttaagatcatcatcataatcattcaaattgaaatttatgtcagcaccaactcccctaaatttaatcgcagcttgatcataggctct |
46007825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 181 - 231
Target Start/End: Original strand, 21890934 - 21890984
Alignment:
| Q |
181 |
gatttacctagcagcagcatgagctgtgtcaaatccacctacaaaattcaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21890934 |
gatttacctagcagcagcatgagctgtgtcaaatccacctacaaaaatcaa |
21890984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 46007752 - 46007702
Alignment:
| Q |
181 |
gatttacctagcagcagcatgagctgtgtcaaatccacctacaaaattcaa |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
46007752 |
gatttacctagcagcagcatgaactgtgtcaaatccacctacaaaaatcaa |
46007702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 41049615 - 41049528
Alignment:
| Q |
18 |
gtttaagatcatcatcgtaatcattcaaattgaaatttatgtcagcaccaactcccctaaacttaatagcagctcgatcgtaggctct |
105 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |||||||| |
|
|
| T |
41049615 |
gtttaagatcatcatcataatcattcaaattgaaatttatgtcagcaccaactcccctgaatttaatcgcagctcgatcataggctct |
41049528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 181 - 231
Target Start/End: Complemental strand, 41049456 - 41049406
Alignment:
| Q |
181 |
gatttacctagcagcagcatgagctgtgtcaaatccacctacaaaattcaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41049456 |
gatttacctagcagcagcatgagctgtgtcaaatccacctacaaaaatcaa |
41049406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 181 - 239
Target Start/End: Complemental strand, 13621428 - 13621369
Alignment:
| Q |
181 |
gatttacctagcagcag-catgagctgtgtcaaatccacctacaaaattcaaccacaaat |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
13621428 |
gatttacctagcagcaggcatgagctgtgtcaaatccacctacaaaaatcaaacacaaat |
13621369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 46 - 105
Target Start/End: Complemental strand, 39644518 - 39644459
Alignment:
| Q |
46 |
attgaaatttatgtcagcaccaactcccctaaacttaatagcagctcgatcgtaggctct |
105 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||||||| |||||||||||||| |||||||| |
|
|
| T |
39644518 |
attgaaattaatgtcagcatcaagtcccctaaactttatagcagctcgatcataggctct |
39644459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 39644364 - 39644323
Alignment:
| Q |
183 |
tttacctagcagcagcatgagctgtgtcaaatccacctacaa |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39644364 |
tttacctagcagcagcatgagccgtgtcaaatccacctacaa |
39644323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University