View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4793_high_32 (Length: 235)

Name: NF4793_high_32
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4793_high_32
NF4793_high_32
[»] chr7 (1 HSPs)
chr7 (34-217)||(32227490-32227672)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 34 - 217
Target Start/End: Original strand, 32227490 - 32227672
Alignment:
34 gttctttttgtggttgtcatgacaatgggaggaattgtgtagaataaaagagtagtcagtggacatgtttttgtgttcctctctcttgaactaaggttgg 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
32227490 gttctttttgtggttgtcatgacaatgggaggaattgtgtagaataaaagagtagtcagtggacatgtttttgtgttcctctctcttgaac-aaggttgg 32227588  T
134 gactgctctacgatgtattgtttataatttttggtggataacatctacataaattatcttgaatgtttcagtatagatcgtttg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
32227589 gactgctctacgatgtattgtttataatttttggtggataacatctacataaattatcttgaatgttccagtatagatcgtttg 32227672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University