View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4793_low_12 (Length: 340)
Name: NF4793_low_12
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4793_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 329
Target Start/End: Original strand, 4406058 - 4406369
Alignment:
| Q |
18 |
aaaacagaggtgaaaatgaatgtgggctatcttgcgccttaggtgttgagggtcacgccgaggatgcggagtcgggttatattgacccggaaagggctgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406058 |
aaaacagaggtgaaaatgaatgtgggctatcttgcgccttaggtgttgagggtcacgccgaggatgcggagtcgggttatattgacccggaaagggctgt |
4406157 |
T |
 |
| Q |
118 |
tgttgggtcgggtcctaaatgtagaggctgcggagaacgggttgcttcggttgttgtgttgccgtgtcgacatttatgtgtttgtactgaatgtgacaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406158 |
tgttgggtcgggtcctaaatgtagagggtgtggagaacgggttgcttcggttgttgtgttgccgtgtcgacatttatgtgtttgtactgaatgtgacaca |
4406257 |
T |
 |
| Q |
218 |
cgtttcggtgtttgccccgtttgtttcactgttaaaaattcaaccgttgaggtttatttatcttaggttgattttcacaatcacatgatgcatgtgtttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406258 |
cgtttcggtgtttgccccgtttgtttcactgttaaaaattcaaccgttgaggtttatttatcttaggttgattttcacaatcacatgatgcatgtgtttg |
4406357 |
T |
 |
| Q |
318 |
ttcatcagaatt |
329 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4406358 |
ttcatcagaatt |
4406369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University