View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4793_low_17 (Length: 324)

Name: NF4793_low_17
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4793_low_17
NF4793_low_17
[»] chr4 (1 HSPs)
chr4 (134-313)||(22617104-22617283)
[»] chr2 (1 HSPs)
chr2 (256-313)||(39643910-39643967)


Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 134 - 313
Target Start/End: Original strand, 22617104 - 22617283
Alignment:
134 cgtgtcagataaattcaattaaatacaactatacattaccaaaatcaaacttcatataaatataataatcaaactatatagagtaaattcaacaaaatta 233  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
22617104 cgtgtcagataaattcaattaaatacaactataaattaccaaaatcaaacttcatataaatataataatcaaactatattgagtaaattcaacaaaatta 22617203  T
234 atttcatattactccgaaatttacgaaccagatatgcgattcccatctaccagtcctgcgataaaacgtaacacctctgt 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22617204 atttcatattactccgaaatttacgaaccagatatgcgattcccatctaccagtcctgcgataaaacgtaacacctctgt 22617283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 256 - 313
Target Start/End: Complemental strand, 39643967 - 39643910
Alignment:
256 acgaaccagatatgcgattcccatctaccagtcctgcgataaaacgtaacacctctgt 313  Q
    |||||||||||||| ||||||||||| ||||| || ||||||||||| || |||||||    
39643967 acgaaccagatatgtgattcccatcttccagttctccgataaaacgtgactcctctgt 39643910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University